AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                --------->AHL12(1)
                              --------->WOX13(2)
                              <---------WOX13(2)
                              <---------AHL12(2)
                              --------->AHL12(2)
                             --------->AHL20(3)
                             <---------AHL20(2)
                             <---------AHL20(3)
                             --------->AHL20(2)
                             <---------AHL25(3)                    --------->AHL12(1)
                            --------->AHL20(2)                     --------->AHL25(2)
                            --------->AHL25(3)                     --------->AHL20(3)
                            <---------AHL25(3)                     <---------AHL12(1)
                            <---------AHL25(1)                     <---------AHL20(3)
                            <---------AHL20(2)                     <---------AHL25(2)
                            --------->AHL25(1)                    --------->AHL12(2)
                           --------->AHL12(2)                     <---------AHL12(2)
                           <---------AHL12(2)                    <---------AHL20(2)
                           --------->AHL12(3)                    <---------AHL12(3)
                           --------->AHL25(2)                    <---------AHL25(1)
                           <---------AHL25(2)                    <---------AHL25(3)
                           --------->AHL25(3)                    --------->AHL25(1)
                           <---------AHL12(3)                    --------->AHL25(2)
                          <---------AHL12(2)                     <---------AHL25(2)
                          --------->AHL12(2)                     --------->AHL12(3)
                          --------->TOE2(3)                     --------->AHL20(2)
                         --------->AHL12(1)                     <---------AHL20(1)
                         <---------AHL12(1)                     --------->AHL12(3)
                        --------->ICU4                          <---------AHL20(2)
                       --------->AHL12(3)                       --------->AHL25(2)          --------
                       <---------AHL12(2)                       <---------AHL25(2)          <-------
                       <---------AHL12(3)                       --------->AHL20(3)        <---------AHL12(2)
                    --------->AHL12(2)                          <---------AHL25(3)        --------->AHL12(2)
                    <---------AHL12(2)                          --------->AHL25(3)        --------->WOX13(2)
                  --------->AHL20(2)                            --------->AHL25(1)        <---------WOX13(2)
                  <---------AHL12(1)                            <---------AHL20(3)       --------->AHL20(2)
                  <---------AHL20(2)                        <---------AHL25(3)           <---------AHL25(3)
                  <---------AHL25(3)                        <---------AHL25(1)           <---------AHL20(3)
                  --------->AHL12(1)                        --------->AHL12(1)           --------->AHL20(3)
                  <---------AHL25(1)                        <---------AHL12(1)           <---------AHL20(2)
                  --------->AHL25(1)                       <---------AHL20(3)           --------->AHL25(3)
                 <---------AHL20(2)                        --------->AHL20(2)           <---------AHL25(1)
                 --------->AHL25(3)                        <---------AHL20(2)           --------->AHL25(1)
                 --------->AHL20(3)                        --------->AHL20(3)           <---------AHL20(2)
     --------->RVE1(1) --------->AHL12(2)                  --------->AHL25(3)           --------->AHL20(2)
    --------->GLK1(2) <---------AHL20(2)                  <---------AHL12(2)            --------->AHL12(1)
    --------->RVE1(2)--------->AHL20(2)                   <---------WOX13(2)            <---------AHL12(1)
    <---------ARR11(3)<---------ICU4        --------->AHL20(2)  <---------AHL25(1)     --------->AHL12(2)
---------TOE2(3) --------->AHL20(2)         <---------AHL25(3)<---------WOX13(2)       <---------YAB1
-----WOX13(2)    <---------AHL20(3)         <---------AHL25(1)--------->WOX13(2)       <---------AHL12(2)
---->WOX13(2)   --------->AHL12(2)        <---------WOX13(2)<---------AHL20(2)         xxxxxxxxxxxxx
------->AGL15   <---------AHL12(2)        <---------AHL12(2)--------->AHL20(2)        --------->AHL12(2)
--------AGL15   <---------WOX13(2)        --------->WOX13(2)--------->AHL25(1)      --------->ICU4
-------->AGL3   --------->WOX13(2)      <---------AHL12(1)--------->WOX13(2)        <---------YAB1<-
---------AGL3 --------->AHL20(2)<---------AHL20(2)      --------->AHL20(2)         --------->TOE2(3)
-GT1--------->ARR11(3)<---------AHL25(3)--------->AHL20(2)--------->AHL12(2)      <---------ICU4----
 
ttaagaaaatctctgtataaattaataaatattaatttatcgataaattaaaacatctataaattaataaaattttgcagtctcaacattattaatttat  13668900
                                       --------->ARR11(3)
                                       <---------ARR11(3)
                                      <---------CCA1(2)
                                    <---------AHL20(3)
                                    --------->AHL25(1)
                                    <---------AHL12(3)
                                    --------->AHL20(2)
     <---------At5g28300            --------->AHL12(3)
    <-----------GT1    --------->ARR11(2)                     --------->MYB52(1)
->AHL20(2)             <---------ARR11(2)                     ------>MYB46(1)
--AHL20(2)             <---------ARR14(2)<---------ANAC58     -------->P                        <---
xxxxxxxxxx>smallRNA(si3)            --------->AHL20(3)        ------>MYB83              ----------->GT1
--------TOE2(3)        --------->ARR14(2)<---------ANAC58    ------>ZmHOX2a(1)        <------ZmHOX2a(1)
------>DOF2            ------->TEIL <---------AHL25(1)   <---------GATA12  <-----------GT1     <----
 
aaaggttttactgtatttgataaacgaatcccttgcgatttatatcttgctgtatttctaaatcctaccgaagttttttttctactgtaggaagtaattc  13669000
                                                                                              <-----
                                                                                            --------
                                                                                            <-------
                                                               >>>>>>>>>MYB98               --------
                                                               --------->WOX13(2)           <-------
      --------->ARR11(3)                                     ------>ZmHOX2a(1)              --------
      --------->RVE1(2)        <---------KAN1               <---------MYB59                 --------
     <---------CCA1(2)     <---------YAB1              --------->HSFB2a(1)                  --------
------At5g28300       --------->KAN1                   <---------HSFB2a(1)           <------ZmHOX2a(1)
-------GT1        --------->YAB1                  --------->AHL20(2)        <---------YAB1  <-------
 
acagttttatatctatggtatttataaattctgaatgtctggcattacaacatttaaaacgttcctaacttactccattttcattgtaggagaaataata  13669100
      --------->RVE1(2)
      --------->ARR11(3)
     <---------CCA1(2)
   --------->AHL20(2)
   <---------AHL25(1)
   --------->AHL20(3)
   --------->AHL25(1)
   --------->AHL12(3)
   <---------AHL20(2)
--------->TOE2(3)
----AHL12(2)
->AHL20(3)
--AHL20(3)                                                                              <----------DOF2
->AHL25(2)                                                                      <----------ID1
--AHL25(3)                                                               --------->TOE2(3)<---------
->AHL25(1)                                     --------->AHL12(2)       <-----------------AGL1
->AHL20(2)                                ----------->GT1               ----------------->AGL1
->AHL12(3)                            <---------YAB1<-----------------AGL1------>ZmHOX2a(1) --------
--AHL12(3)             <-----------GT1<---------RVE1(2)             --------->KAN1      <---------DAG2
 
taacatttatatctatgttagtaatataacattttcaaattgctattgttatattttcaaatttggacctcatgttccttagtaggccaaactttacccc  13669200
                                                             ------>ZmHOX2a(1)
                                                       --------->AHL20(1)
                                                       <---------AHL25(3)
                                                       --------->AHL25(2)
                                                       <---------ARR11(3)
                                                       --------->ARR11(3)
                                                      <---------AHL25(1)
                                      --------->KAN1  <---------AHL12(3)
                                <---------HSFB2a(2)   <---------AHL12(2)
                             <----------DOF2   --------->TOE2(3)<---------WOX13(2)
                      --------------->AtSPL3  --------->ANAC55(2)                                 <-
                      <---------------AtSPL3  --------->ANAC46  --------->WOX13(2)                <-
                      --------------->AtSPL8  <---------ANAC55(2)                              <----
                      <---------------AtSPL8  <---------bZIP60(1)  --------->MYB52(1)          -----
 --------->YAB1    <---------AHL20(2) --------->AHL25(1)    --------->TOE1(3)                  -----
<---------YAB1   <---------AHL12(2)   <---------AHL12(1)    --------->TOE2(3)             <---------ANAC46
--GT1           --------->YAB1  --------->HSFB2a(2)   --------->AHL12(3)       <----------DOF2 <----
->ANAC46 <------ZmHOX2a(1)------->TEIL--------->AHL12(1)--------->KAN1   ---------->DOF2 *TSS-------
 
attttcatagtaggagaaataataaaacgtacctttcagaaataatcttacgtcaaaatatatccttaaataacagaaaagtctttttagtcttcgtgta  13669300
            <---------ICU4
            --------->YAB5
            --------->ATHB12
           <---------YAB1
           --------->ICU4
         <---------ICU4
         --------->YAB1
        --------->ICU4
      --------->YAB1
      --------->TOE2(3)
   --------->ARR14(2)
   --------->ARR11(2)                             <---------HSFB2a(2)
   <---------ARR11(2)                            <---------LBD16
   <---------ARR14(2)                          <---------ARR14(2)
  <------ZmHOX2a(1)                          <---------HSFB2a(1)
--------->ANAC46                             --------->HSFC1(2)                         <---------RVE1(2)
--------TOE2(1)                      <------NtERF2--------->HSFB2a(2)                   --------->ARR11(2)
--------TOE1(1)                     ------>NtERF2<------NtERF2 ------->GAMYB            <---------ARR11(2)
-----ARR11(2)                      --------->ETT(2)--------->LBD16                      --------->ARR14(2)
---->ARR14(2)        <-----------TGA1--------->ATERF1(1)      --------->MYB46(3)   --------->MYB52(1)
---->ARR11(2)        <-----------HVH21<---------ANAC46 <---------KAN1      ------->GAMYB<---------ARR14(2)
-----ARR14(2)      <---------YAB5  <---------DEAR3(1)<---------GLK1(2)   --------->At4g35610   -----
-->REM1(2) <---------YAB5    --------->ICU4  --------->HSFB2a(1)         <---------At4g35610   <----
 
tacgaggaaccataatgatttcatcgtcagagatgatggcgacggagaaggctccggaatttgtaacagccatggcaactgaaactgaacggatagggaa  13669400
                                                                                   <---------ICU4
                                                                                  <---------YAB5
                                                                                  <---------YAB1
                                                                                --------->YAB5
                                                                                --------->YAB1
                                                                               --------->ICU4
                                                                               <---------YAB5
                                                                           --------->LBD16
                                     <---------ARR14(2)                   --------->LBD16
                            --------->LBD16                               <---------HSFB2a(2)
                           --------->ANAC46         --------->ARR11(3)    --------->HSFB2a(2)
                           --------->RAP2.6(2)>>>>>>>>>TBF1               --------->ANAC46 ---------
                          XXXXXXXXXXXXXXXXXXXX>MIR167C                   --------->HSFB2a(2)
                        --------->ANAC46 ------>ZmHOX2a(1)               <---------HSFB2a(2)       <
                ----------->GT1      --------->ARR14(2)            <---------ARR11(3)     <---------CCA1(2)
---->GLK1(1)   <------ZmHOX2a(1)     --------->GLK1(2)             --------->ARR11(3)   <---------ANAC58
-----ARR14(2) ----------->GT1    --------->YAB1     <---------ARR11(3)   <---------LBD16<---------ANAC58
 
ttcgagggaagtagatgaggagaaaataagccgcaagaagaatcctgaagaagaagctcttgaagctaaatgtcttcccggaatcatcagtgcttatctc  13669500
       ------>ZmHOX2a(1)
   <---------ARR14(2)
   --------->ARR14(2)                              --------->ARR14(2)         --------->TOE2(3)
 <---------HSFB2a(1)                               <---------GATA12         --------->GATA12
 <---------HSFC1(2)                                --------->GATA12         <---------GATA12
 --------->HSFC1(2)                                <---------ARR14(2)       <---------ARR11(3)
 <------MYB46(1)                                   <---------ARR11(2)       --------->ARR11(3)
 <------MYB83                                     <------NtERF2    -------->ZAP1
 --------->HSFB2a(1)    <-----------GT1         <---------ANAC46 <---------WRKY18(1)
--------->MYB59  ---------->ID1          --------->ARR11(3)     ----------->HVH21
--------->MYB111(1)  <---------DOF5.7(1) <---------ARR11(3)     --------->WRKY12
>RVE1(2)     <-----------GT1--------->YAB1     <---------LBD16  --------->WRKY38(1)               --
--------P <---------DOF5.7(1)        --------->ZAT6--------->ARR11(2) ----------->GT1             --
 
aagtaggttcctgttttttcttcgtttttactcataaatagcactatcttggcggattcaagaagacttgaccgagttaaatcttagacttaagttttct  13669600
                                ------->TEIL
                                <---------ARR11(2)
                             <---------ANAC58
                             <---------ANAC58         <-------GAMYB
                         <---------RVE1(2)            <---------WOX13(2)
                       <------MYB83                   --------->WOX13(2)
                       <------MYB46(1)               --------->MYB55(2)
                <---------ANAC58<---------ARR11(3)   --------->MYB46(2)
                <---------ANAC46<---------ARR14(2)   --------->MYB52(2)
      <-----------GT1<--------P<---------CCA1(2)     <---------MYB46(3)           <-------GAMYB
   <----------DOF2  <-------GAMYB            --------->KAN1                      --------->MYB52(2)
--------->ARR11(3) <---------MYB46(3)        <---------MYB46(3)                  <---------MYB46(3)
<---------ARR11(3) --------->ATHB12       ----------->GT1     <XXXXXXXXXXXXXXXXXXXXMIR827<----------DOF2
------->ANAC58  <---------ANAC58--------->ARR14(2) <---------MYB52(1)        <---------TOE2(3)
------->ANAC58 --------->MYB52(2)  <----------DOF2--------->TOE2(3)      <---------WOX13(2)
 
caagctctttaaccatgttacttggttggattgtgtatctttgtagggtgattcgttagttgagtttgttttggtcatttaagtttgttgtgctttgaac  13669700
               <--------ATHB1
               -------->ATHB1
               --------->ATHB51                                                      ---------->ID1
              --------->ICU4                                                  --------->KAN1 <------
              <---------ATHB12                                                <---------RVE1(1)
              <---------YAB1                                                  <---------CCA1(1)
              <---------ATHB51                                                <---------KAN1 <------
              <---------YAB5                                                 <---------RVE1(2)------
            --------->WOX13(1)                                               <---------ARR11(3)
           ------------>ATHB5              --------->ANAC46              --------->ALFIN1    -------
  --------->ANAC58   --------->WOX13(2)  <-----------GT1              <---------RVE1(2)  <---------DOF5.7(1)
  --------->ANAC58 <---------AHL20(2)--------->AHL20(2)               <---------GATA12   <---------DAG2
 --------->DAG2--------->ATHB12    ------>ZmHOX2a(1)                  --------->GATA12   <----------DOF2
---------->DOF2<---------ICU4      <----------DOF2     <---------DOF5.7(1)   --------->ARR11(3)
 
tcaaaaagcaattggcaattattgaattggcccatgtcctttatatacgactcaagtcccttctcatattttggatgtgggatatttcttcgcttttagg  13669800
<- Previous    Next ->

AGI:  At2g32160.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G32170.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64660.1); contains InterPro domain N2227-like (InterPro:IPR012901)
Range:  from: 13669290    to: 13673299    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version