AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                              ------
                                                                                           <------ZmHOX2a(2)
                                                                      <----------DOF2      ---------
                                                                      <---------DOF5.7(1) <---------ARR11(3)
                                                <---------ALFIN1      <---------DAG2      --------->GATA12
                                            <-----------HVH21      ------>MYB46(1)        --------->ARR11(3)
 --------->MYB52(1)         <-------TEIL  ------>ZmHOX2a(1)        ------>MYB83           --------->AGP1
------->YAB1   --------->ZAT6      <-----------GT1               <---------MYB59          <---------GATA12
-------YAB5  XXXXXXXXXXXXXXXXXXXXXXX>MIR836<---------ICU4       --------->ANAC46    <----------DOF2
 
aacataacagtgtctcttacacttcccttgatacatataaacttcctcatcacaccttctctagtaaacccaactttttcaagaaccctttgagatccaa  13638400
                                                             <-----------HVH21
                                                          ------>NtERF2
                                                          --------->At4g35610
                                              <---------HSFB2a(2)                             <-----
                                              --------->HSFB2a(2)                            <------
                                              ------>ZmHOX2a(1)                              <------
      --------->RVE1(2)                       --------->LBD16--------->At5g28300             <------
     --------->ANAC46               --------->HSFB2a(2)   --------->LBD16         --------->LBD16
  --------->ETT(2)                  <---------HSFB2a(2) <---------LBD16          <---------ANAC58
  <---------ZAT18                  <---------LBD16 <---------KAN1                <---------ANAC58
----->RAV1(1)         --------->ANAC58  --------->KAN1--------->AtMYB61 <---------ALFIN1    <-------
>CCA1(2)              --------->ANAC58  <---------GLK1(1) <---------At4g35610    <---------ANAC46  -
 
cattgtccacatcaacaagtgcctcaagcctttcaatctctggaaattcctcgaatacctccgcggtcactagcctcactgcttccgtggcaaacccttt  13638500
                                                       --------->ICU4
                                                  --------->DREB2C(2)
                                                  ------->GAMYB--------->ARR11(3)
                                                  --------->ANAC46
                                                  --------->ANAC58
                                                  --------->DEAR3(1)
      <----------DOF2           <----------DOF2   --------->ANAC58
----DOF5.7(1)                  <---------DOF5.7(1)--------->RAP2.6(2)
----DOF2                   ------>MYB46(1)       --------->MYB46(3)          <---------ORA47(1)
---DAG2                    ------>MYB83          <---------MYB55(2)     <---------ARR11(2)
---DOF5.7(1)            --------->MYB46(3)       --------->DEAR3(2) <---------At4g35610        <----
--DOF5.7(1)         <---------MYB59             -------->P     <---------ARR11(3)              -----
-------->LBD16   <------ZmHOX2a(1)            --------->MYB46(3)<---------REM1(1)           <-------
 
tccccaatactttctcgctaggacataaccaatctcttttctgatgttatcaaccgccatgatcaagatgtagccgattggacggtcgtcttctaagcag  13638600
                                    <---------ANAC55(2)
                                 <---------ARR11(2)
                                 --------->ARR11(2)
                             <------ZmHOX2a(2)
                          --------->ANAC58
                          --------->ANAC58
                      <------ZmHOX2a(1)------->TEIL
                      ==============HOX2a_HOX2a                  <---------AtLEC2
         --------->MYB52(1) --------->ARR14(2)                <-------MYC2                         <
      ------>NtERF2   ===============HOX2a_HOX2a              ------->PIF5                    <-----
<---------ANAC46    >>>>>>>GRF7  <---------MYB52(1)           ------->MYC2                    <-----
-----At4g35610   <-----------HVH21  --------->ANAC55(2)       ------->MYC3                 <--------
---->At4g35610--------->ALFIN1------>ZmHOX2a(2)               <-------MYC3                ----------
--At4g35610   <---------KAN1--------->GATA12      <-------TEIL<-------PIF5     --------->ZAT18======
 
atggctcggagccaagggtgtgtcaggacacgatcggttatgtatttgatagcttcgtctcggctcgtgcaaggctcccaagtgcaaaatcgagccactt  13638700
   <-----------RAV1(1)
  ------>ZmHOX2a(2)
 <------ZmHOX2a(2)
 <---------KAN1
<---------GATA12
--------->GATA12
<---------ARR11(3)                                       --------->KAN1
--------->ARR11(2)                                       <---------RVE1(1)
--------->GLK1(2)                                       --------->ARR11(3)
--------->ARR11(3)                                 <------NtERF2
--------->ARR14(2)                                <------NtERF2      <---------DEAR3(1)
<---------ARR14(2)                 ---------->DOF2--------->LBD16  --------->LBD16
<---------ARR11(2)           --------->O2     <---------SPL7(1)   <---------HSFB2a(2)
<---------AGP1               <---------O2 <---------WRKY38(1)     --------->LBD16
------ZmHOX2a(1)             <---------TGA1a--------->At4g35610  <---------LBD16   <---------YAB1
----DAG2                     --------->TGA1a<---------At4g35610  --------->HSFB2a(2)--------->ATHB51
-----DOF2                    =================bZIP_DOF----------->ARR10<------NtERF2<---------ICU4
-ALFIN1               <---------YAB5 --------->DOF5.7(1)<---------RVE1(2)          <---------YAB5
------->AGL3   --------------------->WRI1<---------YAB5 <---------ARR11(3)         --------->ICU4
=======================================bZIP_DOF <---------LBD16  <---------HSFB2a(2)--------->ATHB12
 
taggatctgtggcccaaaccatgtagtcatcgacgtcggaaagagtcatcggccggagagatattcttcccggaggcgaagagctcattattggattagt  13638800
                                              --------->RVE1(2)                      ------>ZmHOX2a(2)
                                             <---------CCA1(2)                      <------ZmHOX2a(2)
                                        <---------GLK1(1)                          --------->ARR11(3)
                                       --------->ARR11(3)                          <---------ARR11(3)
                                       <---------RVE1(2)                           --------->GATA12
                              <---------WOX13(1)--------->ZAT6              --------->ANAC46
                           <---------YAB5  --------->YAB1                 --------->ANAC46
           --------->RVE1(2)--------->ATHB12*TSS--------->YAB5          <-----------GT1
<---------At4g35610  <------ZmHOX2a(1) <---------ARR11(3)           --------------------->WRI1 <----
----------->RAV1(2)<---------TOE2(3)  <<<<<<<<<RAP2.2               <----------DOF2<---------GATA12<
 
ttcttctgagtccatctccatttaggattagtgattgttttagatatcatatcactacgtctaagcgatgtctttatacacatcgcgatcttgaaaaact  13638900
               <---------ANAC58
           <------------CBF
         <---------MYB52(1)
        <---------DOF5.7(1)                                                       ----------->RAV1(1)
  --------->GLK1(2)                                                              --------->ANAC58
 <---------GLK1(2)                                                               --------->ANAC58 <-
 <---------RVE1(2)                         <---------YAB1                        --------->ANAC46<--
 --------->GATA12                        <-----------GT1                       <-----------GT1<-----
--------->KAN1 <---------ANAC58       <---------ICU4                  <---------ZAT6          <-----
------DOF2<---------ICU4             --------->ICU4                   ----------->GT1   --------->DOF5.7(1)
---------RVE1(2)<----------DOF2--------->ZAT6           <---------RVE1(2)    --------->KAN1   <-----
 
ttgagattctcccttattgcttttgactaaaaaaacactaaatattaccatttgctatagataagtgtatttagtgttaaatatacgacataagatgagg  13639000
                                                                 ---------->DOF2
                                                            <---------------AGL15
                                                            --------------->AGL15
                                                            ========================================
                                                       <-------GAMYB
                                                       <---------ANAC58                        -----
--------YAB5                                           <---------ANAC58                        <----
---------HVH21  --------->WOX13(2)                 <---------ANAC58                <---------HSFB2a(2)
----ANAC58      <---------WOX13(2)        <---------ETT(2) ----------------->AGL1  --------->HSFB2a(2)
----bZIP60(2)<---------RVE1(2)         <----------DOF2<---------MYB46(3)          <---------LBD16
----ANAC58 ----------->GT1  ----------->HVH21      <---------ANAC58         <-----------------AGL1
 
tgtcatcgtgtgagtggataattgtctatatttgaccttggactttcgacacttacttggttgccaaacaaagtattgttctggtttcggaacttaatgt  13639100
                             <-----------HVH21
                           ------->MYC3
                           ------->MYC4
                           <-------MYC4
                           <-------PIF5
                           ------->PIF5
                           <-------MYC2
                           <-------MYC3                                                            -
                           ------->MYC2                                                            -
                          <---------ANAC55(2)                                                      <
                          --------->ANAC55(2)                                                      <
                          ==========================================bZIP_DOF                       -
                          <<<<<<<<<<HY5                                                            -
                          <---------TGA1a                                                          <
                          <--------ABF1                   --------->DOF5.7(1)                      <
                          --------->O2                    --------->DAG2                         <--
                          <---------O2               <---------------AGL15                      <---
                          --------->TGA1a           <-----------------AGL1                     -----
<---------ANAC58          --------->bZIP60(2)   --------->YAB5                                 -----
<---------ANAC58          <<<<<<<<<<AtMYC2<---------AtMYB61  <------ZmHOX2a(1)             ---------
<---------ANAC46          <<<<<<<<<<ABI5--------->ALFIN1 --------->DOF5.7(1)          <---------YAB1
=====================================================================MADS_MADS     <---------YAB1---
---->ALFIN1              <<<<<<<<<<<<AtMYC2     --------->KAN1    <-----------GT1--------->KAN1-----
-------RAV1(1)  --------->ANAC46      <---------ANAC46   ---------->DOF2        <---------ARR11(3)--
 
gttgcttccagttggatgcccacaatgccacgtgtcaaatcgtgtgtggtctgattcccaaaaaggatttaactgtttctcaagttattctaaatggatt  13639200
          ----------->GT1
   <---------AHL20(3)
   --------->AHL20(2)
   --------->AHL20(3)
   --------->AHL25(1)
   <---------AHL25(1)
   <---------AHL20(2)
 <---------AHL12(2)
--------->AHL20(1)
<---------AHL25(3)
<---------AHL20(1)
--------->AHL20(2)
--------->AHL20(3)
<---------AHL25(2)
<---------AHL20(3)
--------->AHL25(2)
<---------AHL12(1)
--------->AHL12(1)
-------->AHL12(1)
-------->AHL25(1)
---------AHL12(1)
---------AHL20(2)
-------->AHL25(3)
-------->AHL12(3)
---------AHL25(1)
---------AHL12(3)                                                                  --------->ANAC58
-------AHL12(2)                                                                    --------->ANAC46
------AHL20(2)                               <---------MYB46(3)                    --------->ANAC58
---->AHL20(2)                                --------->MYB52(2)               --------->ANAC46
---->AHL25(3)                              <---------MYB52(1)                 --------->ANAC58
-->GT1    <---------ZAT6                <---------YAB5            --------->At4g35610             --
------>AHL12(2)                    ------>ZmHOX2a(2)          --------->RVE1(2)   --------->WOX13(1)
---->AHL25(1)  --------->AHL12(2)  --------->YAB1         <<<<<<<<<WRKY18     --------->ANAC58    --
------->AHL25(3)               <---------ATHB12        ----------->GT1    --------->GLK1(2)      <--
 
aaatattttaatactgttaatatttgtggtgcaaatgatcgtaatcgtttgttatatactgtcaaaatcaactcaagaatcaagtcactcaacatgttgt  13639300
<- Previous    Next ->

AGI:  At2g32020.1   
Description:  GCN5-related N-acetyltransferase (GNAT) family protein. similar to GCN5-related N-acetyltransferase (GNAT) family protein [Arabidopsis thaliana] (TAIR:AT2G32030.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71194.1); contains InterPro domain Acyl-CoA N-acyltransferase (InterPro:IPR016181); contains InterPro domain GCN5-related N-acetyltransferase; (InterPro:IPR000182)
Range:  from: 13638139    to: 13638845    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version