AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   -
      --------->KAN1                                                                             ---
     <---------MYB52(1)                                                                          ---
------ARR11(3)                                                                                   ---
----->ARR11(3)                                                                                  ----
----->RVE1(2)                                                                                  <----
-----CCA1(2)                                        --------->RVE1(2)                          <----
---AHL12(2)                                         <---------ARR11(3)                         <----
--AHL25(3)                                          <---------AHL20(1)                         <----
>AHL20(2)                                           --------->ARR11(3)                         <----
-AHL12(3)                                 <---------RVE1(2) <---------DOF5.7(1)               ------
-AHL20(2)                            --------->WOX13(2)    <----------DOF2                    ------
-AHL25(1)                  --------->AtLEC2   ----------->GT1                                 ------
>AHL25(1)      <---------MYB52(1)    <---------WOX13(2)<----------DOF2                        ------
 
atctatctgttattctcagttttgttcttcatgaaaactcaattgcatattgtaatatctttcttttttttgttttctgttttgccttcaacttcacacc  11829400
       <-----------GT1
     <---------AHL20(2)
   --------->AHL12(3)
   --------->AHL12(2)                            <-----------ARR10
<---------AHL20(1)                               ------->TEIL
-------->YAB1                                    <---------ARR11(1)
--->MYB83                                        <---------ARR11(2)
--->MYB46(1)                                     <---------ARR14(2)
------>MYB52(1)                                  --------->ARR11(2)
----->MYB55(1)                                   --------->ARR14(2)
-----MYB111(2)                                  <---------ARR14(1)
-----MYB111(1)                                  <---------CCA1(2)
-----MYB46(2)                                 --------->ANAC46                            <---------KAN1
-----MYB52(2)                                 <---------ANAC55(2)               <---------ATHB12
-----MYB59                                    --------->ANAC55(1)              ------>MYB83<--------
--->ANAC46                                    --------->ANAC55(2)              ------>MYB46(1)
--->ANAC58   --------->GATA12           <<<<<<<<<GATA-1        <---------AHL20(2)    --------->YAB1
--->ANAC55(1)--------->RVE1(2)      <---------DAG2      ---------->ID1       <---------MYB59
--->ANAC58   <---------GATA12       <----------DOF2 <----------DOF2        ------------------------>ANAC81
 
taacatattttttctaaatctaatccatacatttccctactttatctatacgtatctttgtcttatttatagattgagaaccaaacaatgagaataacat  11829500
                                                                                    <---------------
                      ------>MYB46(1)                                         <---------DOF5.7(1)
                      ------>MYB83                                            <----------DOF2
                 --------->ANAC46                                          --------->ARR11(3)
            <---------YAB1      --------->AHL12(2)                         <---------ARR11(3)
   -------->P--------->YAB1--------->ANAC58                           ------>MYB83  --------->PCF2
--------->At4g35610 --------->AtMYB61                                 ------>MYB46(1)
<---------At4g35610 --------->MYB46(3)    <-----------GT1             -------->P  <-----------GT1  <
---GT1    --------->YAB1   --------->ANAC58      --------->AHL20(2) --------->TOE1(2)  <---------ALFIN1
 
tttagctacctatttataatacaccaactcaagaaaattgttgtattaccaattcaatataaacatgttaacctacaagaccttttagccccacttggta  11829600
                                          --------->AHL12(3)
                                          <---------AHL12(3)
                                          <---------AHL12(2)
                                         <---------AHL20(2)
                                         --------->AHL20(2)
                                         <---------AHL20(1)
                                         --------->AHL20(3)
                                         --------->AHL20(1)
                                         <---------ARR11(3)
                                         <---------AHL25(2)
                                         <---------AHL20(3)
                                         <---------AHL12(1)
                                         --------->AHL12(1)
                                         <---------AHL25(3)
                                         --------->AHL25(3)
                                         --------->AHL25(1)
                                         <---------AHL25(1)
                               --------->MYB46(3)
                  <-----------GT1        --------->AHL25(2)
                  ---------->ID1  ------>MYB83
<---------DOF5.7(1)           ------->TEIL<---------AHL25(1)
--AG <-----------GT1 <----------DOF2     --------->ARR11(3)     <---------YAB1
----------DOF2   <-----------GT1  ------>MYB46(1)--------->AtLEC2           <-----------GT1
 
ttctttttttactatatgtttttcctttctatgaaccaacttaatatatttcatacaaaattagtttctgattcaaattttgccctactaagtctctaaa  11829700
                                 <---------WRKY18(1)
                                --------->WRKY12
                                --------->WRKY38(1)
                             <---------MYB46(3)        <---------YAB1
                <---------YAB5<-------GAMYB         <---------YAB5
             <---------AHL20(2)<---------WOX13(1)   ---------->ID1            <---------RVE1(2)
          --------->YAB5    <---------AtMYB61       <---------YAB1           --------->ATHB12
         <---------YAB1     --------->ALFIN1  <---------KAN1                <---------YAB1
       <---------KAN1 <---------RVE1(2)      <----------DOF2    ----------->GT1      <---------DOF5.7(1)
 
taagtttagaatatgtttaatcagggatagtgtggttgactgagagggcatttttgtcattatacatcggtaacaagtcttgataggctcttaaggccag  11829800
                                                                   ================================HOX2a_HOX2a
                                                                   ===============================HOX2a_HOX2a
                                                             =============HOX2a_HOX2a
                                                             <------ZmHOX2a(2)
                                                             --------->At4g35610                   -
                                                            --------->GLK1(2)                     --
                                                            --------->ARR14(2)              ------>ZmHOX2a(2)
                                                            --------->ARR11(3)             <------ZmHOX2a(2)
                                                            --------->GATA12              --------->ARR11(2)
                                                            <---------GATA12              <---------ARR11(2)
                                                            <---------ARR11(3)            <---------ARR14(2)
                                                            --------->RVE1(2)             <---------ARR14(3)
                           <-----------RAV1(1)              <---------ARR11(2)            --------->ARR14(2)
                        <----------DOF2                     --------->ARR11(2)            <---------RVE1(2)
                       <---------DOF5.7(1)                  <-----------ARR10             --------->AGP1
                  <---------KAN1                            <---------AGP1                <---------AGP1
                  <---------GLK1(1)                     --------->DOF5.7(1)               --------->ARR14(3)
                  --------->GLK1(1)            =====================HOX2a_HOX2a           --------->ARR11(3)
                  <---------At4g35610          ======================HOX2a_HOX2a          --------->GATA12
             --------->ANAC58                  <------ZmHOX2a(1)   <------ZmHOX2a(1)      <---------ARR11(3)
             --------->ANAC58       ----------->GT1    --------->DOF5.7(1)          --------->ANAC58
         <-----------GT1<---------DOF5.7(1)  <---------TOE2(3)------>ZmHOX2a(2)     --------->ANAC58
        *TSS --------->ANAC46  <---------At4g35610     ---------->DOF2    --------->YAB5  <---------GATA12
    <-----------TBP    <---------DAG2    --------->WOX13(2) <---------ARR14(2) --------->ANAC58   <-
 ----------->GT1  --------->At4g35610    <---------WOX13(2)<------ZmHOX2a(1)   --------->ANAC58   --
 
tcttgggttatataacaaggcatctcccttttggtgctcatgtaaattgaggaagagaaaaaggatctgaggaacaatggctacgacaagacagatcttg  11829900
                <---------AHL20(2)
                --------->KAN1
         ------->GAMYB                      --------->TOE2(3)                  --------->DOF5.7(1)
     --------->KAN1                        <---------KAN1                    ---------->DOF2
   ----------->RAV1(1)               <---------LBD16               --------->ATHB12
   --------->RAP2.6(2)              <---------LBD16 --------->ATHB12 <---------WOX13(1)
--------->RAP2.3(3)             <---------ARR11(3) <---------KAN1  --------->YAB5         <---------
-------->ATERF1(1)              --------->ARR11(3) <---------YAB1 <---------YAB1        --------->At4g35610
------->ZAT2   --------->AHL20(2)--------->ZAT2  <---------AtLEC2 <---------ATHB12    <------ZmHOX2a(1)
--------At4g35610         ------->TEIL--------->LBD16            <---------TOE1(2)  --------->ALFIN1
------->At4g35610         --------->RVE1(2)--------->KAN1       ------>ZmHOX2a(1) --------->DOF5.7(1)
 
gagcagccacaatcgccatttattcaacgtatcaagagctcggggaacattagcatgaatggcagtcctatgattgatgagaaagaagaggagctttcac  11830000
                                                                           ---------->DOF2
                                                                       --------->LBD16
                                                                 <---------------AtSPL8
                                                              --------->ARR14(2)
                                                              <---------ARR14(2)
                                                              <---------ARR11(2)                 ---
                                                             <------ZmHOX2a(1)                   <--
                 <---------TOE2(3)                         <---------TOE2(3)                     <--
                 <---------TOE1(3)                    <---------MYB46(3)   --------->DOF5.7(1)  ----
         <----------DOF2                     <------ZmHOX2a(1)--------->ARR11(2)                ----
        <---------ANAC58    --------->At4g35610      <---------TOE2(3)--------->HSFB2a(2)     <-----
   <----------DOF2   ---------->DOF2      <------ZmHOX2a(1)<---------TOE1(3)--------->DAG2  <-------
-DOF2   <---------ANAC58    <---------At4g35610--------->DOF5.7(1)    <---------HSFB2a(2)<----------CDC5
 
agtctgcttttgctttgtttaaggcaaaggaagatgagattgagaggaggaagatggaggttaaggatagggtccagaaaaagcttggactcgctgagga  11830100
                    <-------TEIL
                   --------->GLK1(2)
                   --------->CCA1(2)
                   --------->ARR14(1)
                  <---------GATA12
       --------->YAB5 <---------HSFB2a(2)
  --------->HSFB2a(2) --------->HSFB2a(2)                              <---------YAB1
  <---------HSFB2a(2)<---------LBD16                                  <-----------GT1
------>HSFC1(2)   --------->GATA12                                 <---------ARR11(3)
-------HSFC1(2)   --------->ARR11(1)      <-----------GT1          --------->ARR11(3)
-------At4g35610  <---------GLK1(2)<------MYB83                    <---------RVE1(2)
----->ANAC58      --------->ARR14(2)   ----------->GT1             <---------GLK1(2)
----->ANAC58      <---------ARR14(2) <---------ANAC46            ----------->ARR10          --------
-ZmHOX2a(1)      --------->KAN1    <------MYB46(1)    --------->ARR11(3)                   <--------
--TOE2(3)       ----------->ARR10 --------->MYB59     <---------ARR11(3)                <---------AtMYB61
 
agctactagaagattagccgagattcgggaagtaagtttggtttgtaacattttcaagaacttgaacaaagattttcattttgagagagttttggtttgt  11830200
                                                        <------ZmHOX2a(1)
                                                       <----------ID1
                                                --------->LBD16
                                --------->YAB1<---------LBD16
                               <---------ATHB12--------->ANAC46
                          <------ZmHOX2a(2) --------->ARR14(2)
                          =====================================HOX2a_HOX2a
                         <---------ARR14(2) --------->ARR11(2)
                         <---------GATA12   <---------ARR14(2)
                         --------->ARR14(2)--------->CCA1(2)
                         --------->ARR11(2)--------->GLK1(1)
                         <---------ARR11(2)--------->KAN1
                <-----------ARR10          <---------GLK1(1)
      <------ZmHOX2a(1)  --------->GATA12 <---------ARR11(3)
      ===========================HOX2a_HOX2a<---------ARR11(2)                          --------->ANAC58
   <---------LBD16<---------DOF5.7(1)     <---------RVE1(2)                   ------->GAMYB <-------
   <-----------RAV1(2)   --------->RVE1(2)--------->ARR11(3)--------->DOF5.7(1)         --------->ANAC58
------->AtSPL8  --------->ARR11(3)    --------->DOF5.7(1) ---------->DOF2   <---------At5g28300
-ANAC46         <---------ARR11(3)  ---------->DOF2   <---------TOE2(3)    --------->MYB52(1)    <--
 
acattttcaggagcttgaagctcttaccgatccaatgagaaaagagatatccgcgataaggaaaagagtcgatgctattaaccgagaactcaagccttta  11830300
<- Previous    Next ->

AGI:  At2g27740.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G36410.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO16676.1); contains InterPro domain Protein of unknown function DUF662 (InterPro:IPR007033)
Range:  from: 11829809    to: 11830809    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version