AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                        <---------ARR11(2)
                                        --------->GATA12
                                        --------->ARR11(2)
                                        <---------ARR14(2)
                                        <---------RVE1(2)
                                        <---------GATA12
                                        <---------GLK1(2)
                                        --------->ARR14(2)                             <---------WOX13(2)
                                       --------->KAN1                        <---------ANAC58
   <---------HSFB2a(2)          <---------GLK1(2)                            <---------ANAC58
   --------->HSFB2a(2)         --------->KAN1                              --------->ANAC58
------->KAN1              --------->ANAC58                                 --------->ANAC58
------HVH21               --------->ANAC46                       --------->RVE1(2)     --------->WOX13(2)
---->GT1 ---------->DOF2  --------->ANAC58<-------TEIL        --------->YAB1--------->ZAT2
 
caaattcgagaccaaagtagggttcttacaagacacattctcagattcgtcaacaattcgttcaatagtatcgaagacaagcttgctatcaactaagtac  11300100
                                                        <---------YAB5
                                                     <---------YAB5
                                                     <---------YAB1
                                                   <---------ICU4
                                                  <---------YAB5
                                                <---------ICU4
                                                --------->YAB1
                                               <---------YAB1
                                               <---------YAB5
                                             <---------ICU4
              <---------ANAC58               --------->YAB1
              <---------ANAC58              <---------YAB5                   <<<<<<<<<TBF1
          <----------DOF2                   XXXXXXXXXXXXXXXXXXXX>MIR414   <<<<<<<<<TBF1
         <---------DOF5.7(1)        <---------MYB52(1)<---------ICU4   <<<<<<<<<TBF1       <--------
        <---------DOF5.7(1)        <----------DOF2<---------YAB1    <<<<<<<<<TBF1     --------->HSFB2a(2)
  <-----------GT1                 --------->TOE2(3)--------->YAB1<<<<<<<<<TBF1        <---------HSFB2a(2)
 
ttaagaaacccttctttgctaggcttccaagtctcttcctttacttcatcatcatcatcatcgtcttcttcttcttcttcttcttccttctcggtgtcag  11300200
                         <---------YAB1
                    <---------AHL12(2)
                   <---------AHL20(3)
                   <---------AHL20(2)
                   --------->AHL12(1)
                   --------->AHL25(2)
                   <---------AHL25(1)
                   --------->AHL25(1)
                   <---------AHL25(3)
                   <---------AHL12(1)
                   --------->AHL20(3)
                   <---------AHL25(2)
                   --------->AHL20(2)
              ------>ZmHOX2a(2)
             --------->CCA1(2)
             <------ZmHOX2a(2)                           <---------KAN1
            --------->RVE1(2)        <---------ANAC46   ------->TEIL
            <---------GATA12         <---------ANAC55(2)--------->RVE1(2)
            --------->GATA12         --------->ANAC55(2)--------->GLK1(2)
            <---------AGP1           <---------ANAC58   <-----------ARR10                  <--------
            <-----------ARR10        <---------ANAC58   <---------GATA12                  --------->LBD16
            <---------ARR11(3) <---------YAB5       <------NtERF2                         ------>ZmHOX2a(1)
            --------->AGP1--------->YAB5--------->ARR14(2)                      <---------ATHB12
            --------->ARR11(3) <---------YAB1      ------>NtERF2           >>>>>>>>>>>>>>>>>LFY
          --------->DOF5.7(1)  <---------TOE2(3)  <----------ID1   ------>ZmHOX2a(1)     <---------LBD16
---HVH21---------->DOF2<-----------GT1  <---------ARR14(2)        --------->TOE2(3)     ----------->RAV1(2)
 
ttttatcttcagaaagatctaattttttaccattaacattgcgtaatctcatggcgacgaatctcatttcctcagttataccaatgttttctcctgggta  11300300
                                                             ----------->RAV1(1)
                                                   <------MYB83
                                                  <---------AtMYB61                       <---------
                                               --------->ALFIN1                          <---------ANAC58
             ---------->ID1              ----------->TGA1   --------->ANAC58             <---------ANAC58
         <---------ANAC58        <----------DOF2 <--------P --------->ANAC58          <---------RAP2.6(2)
         --------------------->WRI1 <-----------RAV1(1)  <---------SPL7(1)            ---------->ID1
       ------->TEIL              <---------DOF5.7(1)   <------NtERF2                <-----------RAV1(1)
      <---------CCA1(2)         <---------DOF5.7(1)<------MYB46(1)               <----------DOF2
    ------>ZmHOX2a(1)         ------>NtERF2    <-----------RAV1(1)              <---------ANAC58
  <---------ANAC46    ------>ZmHOX2a(1)  ----------->HVH21 --------->SPL7(1)    <---------ANAC58
-TOE1(2) <---------ANAC58<-----------HVH21  <---------DEAR3(1)             --------->DOF5.7(1)
 
ttgtttcctgtaccttgttctcttcctctgtgaggccttttgttgtgacggtgttggtgtcgaacgacatagattgagaagatgcttttgtggctttctc  11300400
                                                             --------->ALFIN1
                                                             <---------ANAC46
                   --------->DOF5.7(1)                       <---------REM1(1)
                 ---------->DOF2                        <---------TOE1(1)
      --------->CCA1(2)                                 <---------TOE2(1)
     --------->GATA12                              --------->At4g35610
     <---------RVE1(2)                             <---------At4g35610                        ------
   ----------->ARR10                        <---------KAN1 <---------ANAC46                   ------
   <---------TOE2(3)               --------->ICU4<---------ZAT18                  <---------ANAC58
-DOF2<---------GATA12         <---------ANAC46   --------->ZAT18                  <---------ANAC58
 
tgagttgagatttggaatgggaaagagatagatgtgtgaagatgagagtgagtgagcttacgaggtgtagagagtaatggagttggcctgagaagagaag  11300500
                                                                                                   -
                                                                                                   <
                                                                                                   -
                                                                                                  <-
                                                                                                  --
                                                                                         --------->WOX13(2)
                                                                                      <---------MYB52(1)
                                                                                     --------->TOE2(3)
                                                                                 <---------ALFIN1 <-
                          ------>NtERF2                                         --------->MYB46(3)--
                      --------->ANAC46                                         ------>MYB46(1) <----
         --------->MYB46(3)                    <----------DOF2                 ------>MYB83  -------
         --------->DEAR3(1)       <----------DOF2                  <------------CBF  --------->TOE1(3)
--->ANAC58        --------->CCA1(2)    <---------GLK1(1)          --------->ATHB12   <---------DOF5.7(1)
--->ANAC58------>NtERF2--------->At4g35610 ---------->ID1  <----------ID1  >>>>>>>>>MYB2 <---------WOX13(2)
 
ccatggattccgacgaccaagatagacgctgccttcactttgatttctcgctttcagcctaatcgacaaacattggaaaaccaaacacccttaattttgt  11300600
                      --------->AHL12(3)
                      <---------AHL25(1)
                      <---------AHL20(2)
                      --------->AHL20(2)
                      --------->AHL25(1)
                      <---------AHL25(3)
                      <---------AHL12(1)                     <---------AHL20(2)
                      --------->AHL12(1)                     <---------AHL25(3)
                      --------->ATHB51                      --------->AHL12(1)
                      <---------ICU4                        --------->AHL25(1)
                     <---------YAB5                         <---------AHL25(1)
                    --------->WOX13(2)                      <---------AHL12(3)
                    <---------AHL12(2)                      --------->AHL12(3)
       --------->ANAC46                                     --------->AHL20(2)
     <---------AtLEC2--------->AHL25(3)                     <---------AHL20(2)
   <-----------GT1  <---------WOX13(2)                      --------->AHL25(3)
   <---------AHL20(2)--------->ICU4                ----------->GT1
-------->AHL12(1)   --------->AHL12(2)            --------->GATA12
---------AHL12(1)  --------->YAB1                 <---------GATA12
-------->AHL20(2) --------->AHL25(1)             <---------At4g35610
--------YAB1      --------->AHL25(3) --------->TOE2(3)      <---------AHL12(1)
------->AHL12(2)  --------->AHL20(2)<-----------------AG   --------->AHL12(2)
--------YAB5     <---------MYB52(1) ----------------->AG   <---------AHL12(2)                 <-----
------->ICU4--------->ANAC58        ----------------->AGL1<---------AHL12(2)    <-----------GT1
-----YAB1   --------->ANAC58   --------->WOX13(2)--------->At4g35610            <---------AHL20(2)
---->GT1<-----------HVH21  --------->YAB1      <-----------RAV1(2)      <-----------TBP<---------YAB1
 
tattatttacatgtcatgccattaattatttcataactagcctaaatagggcagatgtaaaaaataaatagttttttttatatttacattatgcttagat  11300700
                                                                        --------------------->WRI1
                                                                  <---------ANAC58
                                                                  <---------ANAC58
                                                                  <---------ANAC55(2)
                                                                  --------->ANAC55(2)
                                                                 ------->TEIL
                                                               <---------SPL7(1)
                  --------->DOF5.7(1)                          --------->TOE1(2)
                 --------->DOF5.7(1)                          --------->ANAC55(2)
                --------->DOF5.7(1)   <---------WOX13(2)      <---------ANAC58           <---------ICU4
                ---------->DOF2       --------->WOX13(2)      <---------ANAC58           --------->KAN1
     --------->ANAC58        --------->WOX13(2)               <---------ANAC55(2)       <---------YAB1
     --------->ANAC58        <---------WOX13(2)              --------------->AtSPL3     --------->ICU4
     --------->ANAC46       --------->YAB5<---------TOE2(3)  <---------------AtSPL3--------->ANAC46
  <---------RVE1(2)       <---------RVE1(2)      <----------DOF2 <-------TEIL <---------YAB1
----RVE1(2)    --------->DOF5.7(1)<---------RVE1(2)      <---------------AtSPL3--------->KAN1
 
tagttgataagccataaaaaaaaggcttagataattagattagttgagataactttggtttcagtacgtacgtgtctatgtattattcgccattattcta  11300800
                                                                 <----------DOF2
                                                              <-----------GT1
                                                           --------->WOX13(2)
                                                          <---------AHL20(2)
                                                         <---------YAB1
                                                         --------->AHL25(3)
                                                        <---------AHL12(2)
                                                        --------->AHL12(3)
                                                        <---------AHL12(3)
                                                       --------->AHL12(2)
                                                       <---------AHL12(2)
                                                       <---------AHL25(3)
                                                      <---------AHL25(1)
                                                      <---------AHL12(3)
                                                      --------->AHL12(1)
                                                      --------->AHL20(2)
                                                      <---------AHL12(1)
                                                      --------->AHL25(1)
                                                      --------->AHL12(3)
                                                      <---------AHL20(2)
                                                    <---------AHL12(2)
                                                    --------->AHL12(2)
                                                   <---------AHL20(2)
                          <---------ATHB12        --------->AHL20(2)               ----------->HVH21
                         ------>MYB83  <---------KAN1--------->AHL25(3)       <-------TEIL     <----
            ----------->GT1          xxxxxxxxxxxxxxxx>smallRNA(i)<---------DAG2  --------->ANAC46
        ------->TEIL     ------>MYB46(1)<---------ARR11(2)--------->ATHB12  --------->TOE1(2) ------
--------->YAB1         <---------MYB59 --------->GLK1(1)--------->AHL12(2) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
 
ttagtataatgtatgttgaaaaatgaccaaacattttagagcatttccatccattaaatatttattgactttattcaaacgtacaagtgaccacaatgtg  11300900
                <---------AHL20(2)
                <---------AHL12(3)
                --------->AHL12(3)
                <---------AHL25(1)
                --------->AHL25(1)                                                             <----
                --------->AHL20(2)                                                           ------>ZmHOX2a(1)
                <---------AHL12(2)                                                           <------
             <---------YAB1                                                         <----------DOF2
            <---------AHL12(3)                                              <---------WOX13(1) -----
            --------->AHL20(3)                                            <--------ATHB1    <-------
            <---------AHL20(3)                                            --------->ATHB12 ------>ZmHOX2a(2)
            --------->AHL12(3)                                            <---------ICU4 <---------ARR14(2)
            <---------AHL20(2)                                            --------->ATHB51<------ZmHOX2a(2)
         --------->WOX13(2)                                               --------->YAB1 <---------ARR11(3)
         <---------WOX13(2)                                               -------->ATHB1 <---------ARR11(2)
       <---------YAB1                                                    <---------ATHB12--------->ARR11(2)
       --------->AHL20(2)                         --------->YAB1         <---------ATHB51--------->ARR14(2)
       <---------AHL20(2)                        <---------ATHB12        --------->ICU4  <---------RVE1(2)
     <---------DOF5.7(1)     <-------TEIL        <---------YAB5          <---------YAB1  --------->ARR11(3)
    <----------DOF2        <-------MYC2    --------->MYB52(1)        <-------TEIL===================HOX2a_HOX2a
   --------->TOE2(3)       <-------MYC3   --------->TOE1(2)         --------->CCA1(2)    --------->GATA12
   <---------DAG2  <---------GATA12 <---------ZAT6--------->YAB5   <---------ARR11(3)    <---------GATA12
   <---------DOF5.7(1)     ------->MYC2  <---------MYB52(2)  --------->CCA1(2) <---------ARR11(3)
-----ANAC46 --------->AHL20(2) <----------DOF2   <---------KAN1  --------->ANAC46------>ZmHOX2a(2)
--->ALFIN1<---------YAB1   ------->MYC3  --------->MYB46(3) --------->RVE1(2)  --------->ARR11(3)
 
gtgcaacctttttattaatataaatccaaacgtgcattagtgaaacaaacgaatcatcaacaatatacaagatacaataattgatctctttagatcctaa  11301000
<- Previous    Next ->

AGI:  At2g26550.1   
Description:  HO2 (HEME OXYGENASE 2); heme oxygenase (decyclizing). similar to HY1 (HEME OXYGENASE 1) [Arabidopsis thaliana] (TAIR:AT2G26670.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO61297.1); contains InterPro domain Haem oxygenase-like, multi-helical (InterPro:IPR016084); contains InterPro domain Heme oxygenase (decyclizing), plant (InterPro:IPR016951)
Range:  from: 11298662    to: 11300504    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g26560.1   
Description:  PLP2 (PHOSPHOLIPASE A 2A); nutrient reservoir. similar to PLA IVA/PLP1, nutrient reservoir [Arabidopsis thaliana] (TAIR:AT4G37070.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO61317.1); contains InterPro domain Acyl transferase/acyl hydrolase/lysophospholipase; (InterPro:IPR016035); contains InterPro domain Patatin; (InterPro:IPR002641)
Range:  from: 11300847    to: 11302884    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version