AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                          <---------ANAC46                                                --------->AHL25(2)
            --------->At4g35610     <---------TOE2(3)       <---------ZAT6                <---------AHL25(2)
<---------At4g35610    ----------->HVH21            --------->ANAC58          <---------TOE2(3)
--------WRKY38(1)    <---------At4g35610            --------->ANAC46          <---------TOE1(3)
--------WRKY12       --------->At4g35610  <---------YAB1    ----------->GT1  ---------->DOF2       -
-KAN1    <---------At4g35610   ------->TEIL         --------->ANAC58        --------->AHL25(1)------
 
gtcaactgttacagttgctgagtcaaatgacatgtatttgatgttatacttcaaaacgacatcgtgttaaatgttagaattaaagttatacaaaattttg  10147200
                                                                                             <------
                                                                                          <---------
                                                                                          ----------
                                                                                       <---------AHL25(2)
                                                                                       --------->AHL25(2)
                                                                                       <---------AHL25(1)
                                                                                       <---------AHL25(3)
                                                                                       <---------AHL20(2)
                                                                                       <---------AHL12(3)
                                                                                      --------->AHL12(3)
                                                                                      <---------AHL25(3)
                                                                                      <---------AHL20(1)
                  --------->ANAC58                                                    <---------AHL20(2)
                  --------->ANAC46                                                    --------->AHL25(3)
                  --------->ANAC58                                                    <---------AHL25(2)
                  ----------->HVH21             <---------TOE2(3)                     --------->AHL25(1)
                  --------->O2              --------->WOX13(2)                        <---------AHL25(1)
             --------->ANAC46           --------->At4g35610                           --------->AHL25(2)
      <---------RVE1(2)                 <---------At4g35610                           --------->AHL20(2)
      <---------ARR14(2)                <------NtERF2                <---------YAB1   --------->AHL12(1)
      <---------ARR11(3)     <---------------AGL15                 --------->YAB1     <---------AHL12(1)
      --------->ARR11(3)    <-----------------AGL1       ------>ZmHOX2a(2)         ------>MYB83
      --------->ARR14(2)  <-----------GT1   <---------WOX13(2)     --------->YAB5  ------>MYB46(1)
 --------->RVE1(2)--------->bZIP60(2)   <---------ZAT2  <---------WOX13(1)  --------->HSFB2a(2)
-------->ICU4--------->ANAC58<---------ATHB12  <-----------GT1    <---------YAB1 <---------MYB59
----->GT1    --------->ANAC58--------------->AGL15     --------->GATA12     <---------HSFB2a(2)
 
taaaaatcagatattgaagccacgacgtttcactcatttaggcagcttattaacatttgatcgacaactatcatgagttcgagacctaatttttttgtac  10147300
           <---------AHL20(2)
           <---------AHL25(1)
           <---------YAB1
          <---------AHL20(2)
          --------->AHL12(3)
          --------->AHL25(3)
          <---------AHL25(2)
          --------->AHL20(2)
          <---------AHL12(3)
          --------->AHL25(2)
          <---------AHL25(1)
       --------->AHL12(1)
       <---------AHL12(1)
       <---------AHL20(3)
       --------->AHL20(3)
       --------->AHL25(2)
       <---------AHL25(2)
      <---------AHL12(2)
      --------->AHL12(2)
     <---------AHL20(3)                                                      <-----------GT1
     <---------AHL25(1)                                                    <---------DOF5.7(1)
     --------->AHL20(3)                                       --------->CCA1(2)
     <---------AHL12(3)                                      <---------ARR11(3)
     <---------AHL25(2)                                      --------->ARR14(2)  <---------LBD16
     <---------AHL20(2)                                      <---------RVE1(2)   ----------->RAV1(2)
     --------->AHL12(3)                               ------>MYB46(1)   --------->ANAC55(2)
    --------->AHL20(2)                                ------>MYB83      <---------ANAC55(2)
-----GT1  --------->AHL25(1)         <---------YAB1 <---------MYB59    <-------TEIL --------->ATHB12
------AtSPL8             ---------->DOF2         <---------WRKY18(1) <---------ARR14(2)          ---
----->AtSPL8        --------->ZAT6 ----------->GT1  --------->AtMYB61--------->ARR14(2)   <---------TOE2(3)
 
aactctataaaattttaattctaacacttaaaacgatgttgttataaactcttgaccaaacctagatatgaaaatacgtttttcccctgatttgatgtta  10147400
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                     ----------->HVH21           ---
                                                                 ------->GAMYB                   <--
                                           --------->ANAC46    -------->P                       <---
         <---------ICU4                    --------->ANAC58   --------->WOX13(1)                <---
  --------->ANAC58                         --------->AtLEC2 <------ZmHOX2a(2)                   ----
  --------->ANAC46               <---------ANAC58          --------->AGP1                 <---------
  --------->ANAC58               <---------ANAC46          <---------ARR11(3)          <---------DOF5.7(1)
 --------->LBD16        --------->STY1(2)  --------->ANAC58--------->RVE1(2)          <----------DOF2
<---------ALFIN1   ------->TEIL  <---------AtLEC2          <---------GATA12        <---------AHL20(2)
------>PCF2----------->HVH21     <---------ANAC58          --------->GATA12        <-----------GT1--
 
gccccacgaaactcatgacccgaacctagatagtttgcttgtcttcaagcaaacgctgtccagatcaaccaagtgaagggacttattttcttttttccaa  10147500
<---------LBD16
------ATHB1                                           --------->YAB1
------>YAB5                                      ------------>CBF
------>KAN1        --------->ZAT14           --------->DOF5.7(1)
------>ATHB12      <---------ZAT18          --------->DOF5.7(1)
----------ATHB5    <---------ZAT14         --------->DOF5.7(1)                            --------->ANAC46
------YAB5       --------->ANAC46          ---------->DOF2          <------ZmHOX2a(1)     --------->ANAC58
------ATHB12    ------>MYB46(1)        --------->YAB1<---------ATHB12<---------ARR11(2)   --------->ANAC58
----->ICU4    --------->MYB46(3)      <---------AHL20(2)        --------->LBD16          <----------
--GT1--------->GLK1(1)  <------------CBF  <---------AHL20(2)   <---------HSFB2a(2)     <----------ID1
------->ARR11(1)------>MYB83         --------->AHL20(2)---------->DOF2                --------->DEAR3(2)
 
tgattcggaattcaagacccactacactattgggtcttcatataataaaaggcccaataaaagtctccagaggaaacaaaactaatcgaaacgacgaaac  10147600
        ---------->DOF2                               ----------->GT1
      *TSS                                      --------->DAG2--------->DOF5.7(1)
  ----------->GT1                              ---------->DOF2---------->DOF2 <---------KAN1
 <---------TOE1(3)                           ------------------------>ANAC81  ----------->GT1
 <---------TOE2(3)                  --------->ANAC46---------->DOF2 --------->DOF5.7(1)          ---
-----------WRI1        --------->YAB5        --------->ARR11(3)   ---------->DOF2                <--
 
agttaaggtaacaaagtaaacaaacacgattcccaaaacacgaagaaagataaagcaaagaaaaaaaaagaaagatgaagaatgtgaatcgagtcttctt  10147700
                                                                         ------->PIF5
                                                                         <---------MYB52(1)
                                                                         <-------PIF5
                                                                        --------->LBD16
                                                                        <---------DEAR3(2)
                                                                       --------->DEAR3(1)
                                                                       <---------ATERF1(2)
                                                                       <---------DEAR3(1)
                                                                      <------NtERF2
                                                                      --------->ATERF1(1)
                                                                     <---------ATERF1(1)
                                                                    --------->RRTF1(3)
                                                                    --------->RRTF1(2)
                                                                    --------->RAP2.3(3)
                                                                    --------->RAP2.3(2)
                                                                    --------->ATERF1(2)
                                                                    <---------DEAR3(1)
                                                                    --------->DEAR3(1)
                                                                    <---------ATERF1(2)
                                                                   --------->ATERF1(1)
                                                                   --------->RRTF1(1)
                                                                   --------->DEAR4(2)
                                                                   --------->RAP2.3(1)
                                                                   --------->ERF1
                                                                   --------->RAP2.6(1)
                                                            --------->KAN1
                                                        <---------AHL20(2) --------->ABI4(2)
                                                        <-----------GT1--------->ATERF1(2)
                                                     --------->GATA12--------->ABI4(1)
                                                     <---------GATA12------>NtERF2
                                                <---------ARR14(2) --------->ORA47(2)
                                                --------->ARR14(2)<---------ATERF1(1)
                                                --------->ARR11(2)<---------At4g35610
        --------->RVE1(2)                       --------->RVE1(2) --------->LBD16
    --------->YAB5                              <---------ARR11(2)--------->At4g35610
    <-----------GT1                            <---------CCA1(2)  --------->ABI4(1)
   <---------ATHB12                            --------->KAN1     ------>NtERF2
  --------->RVE1(2)             <----------DOF2--------->GLK1(1) --------->ANAC46
------>HSFB2a(2)       --------->TOE1(1)       <---------GLK1(1) --------->DEAR3(1)                <
-------HSFB2a(2)      ------>ZmHOX2a(1)        <---------KAN1   <---------LBD16       ------>ZmHOX2a(1)
 
ctgcaaatcactatctctcgtcttcctcgttccttctttcactcgttctcatatccgatttacttactccgccgccggtgcttcttctcctaatcgagct  10147800
                                        <---------ANAC46
                                        <---------ANAC58
                                        <---------ANAC55(1)
                                        --------->ANAC55(2)
                                        <---------ANAC58
                                        <---------ANAC55(2)
                                     --------->ARR14(2)
                                     <---------ARR11(2)            <---------MYB46(3)
                --------->ARR11(2)   <---------ARR14(2)          <------NtERF2
                --------->ARR14(2) <---------MYB46(3)            <---------At4g35610
                <---------ARR14(2) <---------HSFC1(2)          <---------RAP2.6(2)
               --------->ARR11(2)  --------->HSFB2a(1)         <---------ANAC46                <----
               <---------GLK1(2)   --------->HSFC1(2)          <------NtERF2               <--------
         <---------ANAC58    --------->LBD16              <-----------RAV1(1)           ------------
         <---------ANAC58  <---------LBD16<---------CCA1(2)<-----------HVH21          <<<<<<<<<TBF1
    <---------AtLEC2     --------->ARR14(2)         ------>ZmHOX2a(1)              <<<<<<<<<TBF1
 --------->ANAC46        <---------ARR14(2)<-----------ARR10  <---------LBD16   <<<<<<<<<TBF1<------
<---------At5g28300  --------->ANAC46--------->ARR11(2)   <---------KAN1   <---------DOF5.7(1) <----
-----------GT1 --------->ARR14(2)  <---------HSFB2a(1) ------>ZmHOX2a(1)  <---------DOF5.7(1)-------
 
attcactgcatggcttccgattcccctcaatccggagatggttccgtctcttctcctcctaatgtcgcggctgttccctcttcttcttcttcttcgtccg  10147900
                                                                                         <---------ANAC46
                                                                                    <---------MYB46(3)
                                                                                   <---------AtMYB61
                                                                                  <---------MYB52(1)
                                                                                 --------->LBD16
                                                                               <---------LBD16
                                                                              --------->CCA1(2)
                                                            <---------DOF5.7(1)------>ZmHOX2a(2)
                                                            <---------DAG2    --------->ARR14(1)
                                                          --------->LBD16     <------ZmHOX2a(2)
                                                          ------>NtERF2      <---------ARR11(3)
                                                        ------>ZmHOX2a(2)    --------->ARR14(2)
    ------>NtERF2                                     <---------RVE1(2)      --------->ARR11(3)
    --------->LBD16                                   --------->GATA12       <---------RVE1(2)
   --------->ANAC46                                   <---------GATA12       <---------ARR14(2)
   --------->ANAC58                                   <---------ARR11(2)     --------->ARR11(1)
   --------->ANAC58                                   --------->ARR11(2)     <---------ARR11(2)
--NtERF2                                             --------->KAN1          --------->AGP1
-SPL7(1)    <---------GLK1(1)                      <---------WOX13(1)        --------->ARR11(2)
--------->WRI1            --------->ZAT14        --------->ATHB12            <---------GATA12
---ZAT18    --------->GLK1(1)                   <---------YAB1               --------->GATA12      <
-----At4g35610   ------>ZmHOX2a(1)            --------------------->WRI1    --------->KAN1      <---
-->SPL7(1)--------->ATHB12<---------ZAT14     <----------DOF2              ----------->ARR10  ------
 
cttcttccgccattgatttcctctctctctgtactcgtctcaaggtaagctttgattgatccgccttacattttcgctaagatccggtggttttgtgtga  10148000
             <------MYB46(1)                           --------->GATA12
             --------->MYB55(2)                        <---------GATA12
             <------MYB83                              <---------ARR14(2)
         --------->ICU4                                --------->GLK1(2)
     ------->GAMYB<---------At4g35610                 --------->GLK1(1)
    --------->ANAC46                                  <---------GLK1(1)
    --------->ANAC58                            <---------ANAC58                                   <
    --------->ANAC58 --------->YAB5             <---------ANAC58                                ----
-----------GT1<-------GAMYB                     <---------ANAC46  <---------MYB52(1)    --------->ANAC46
------YAB1   <---------MYB46(3)             <---------RVE1(2)   <---------ANAC58        --------->ANAC58
--->YAB5 <-----------RAV1(1)             <---------WOX13(1)     <---------ANAC58        --------->ANAC58
 
ttatacaacgcaatgttggttagatgatgcgattgttcttgttgatggattgtgtggaaatctgatttcgttagggaaatgaaacgatttcaagctatgt  10148100
<- Previous    Next ->

AGI:  At2g23820.1   
Description:  metal-dependent phosphohydrolase HD domain-containing protein. similar to metal-dependent phosphohydrolase HD domain-containing protein [Arabidopsis thaliana] (TAIR:AT1G26160.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO66590.1); contains InterPro domain Metal-dependent phosphohydrolase, HD region; (InterPro:IPR003607); contains InterPro domain Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674)
Range:  from: 10147607    to: 10149979    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version