AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                             --------->ARR11(3)
                             <---------ARR14(2)
                             --------->ARR14(2)
                             --------->GLK1(2)
                             <---------ARR11(3)                                                   <-
                             <---------ARR11(1)                                             <-------TEIL
                             --------->GATA12                                             --------->AGP1
                             <---------GATA12                                             --------->ARR11(2)
              <---------CCA1(1)                                                           <---------ARR11(2)
              <---------RVE1(1)                                                           <---------GATA12
             <---------ARR11(3)            <---------WOX13(2)                         ------>ZmHOX2a(1)
             <---------RVE1(2)         --------->WOX13(2)                            --------->TOE2(3)
             --------->ARR11(3)        <---------WOX13(2)             <---------ARR11(3)  --------->GATA12
<---------REM1(1)            <-----------ARR10              <----------DOF2     --------->KAN1  ----
--ETT(2)<-----------HVH21   <---------CCA1(2)---------->DOF2<---------DAG2<---------CCA1(2)<------ZmHOX2a(2)
 
aagttgtagtttgtcagatattttgaattgcaaatcttgtttagttaacaaagtcataaactacttttctcaaaatcatctcttcattccttagatccat  9781500
                                                     --------->ANAC55(1)
                                                     --------->ANAC55(2)
                                                     <---------ANAC55(2)
                                          --------->ANAC55(2)
                                          --------->ANAC46
                                          --------->ANAC58
                                          --------->ANAC58
                                          --------->ANAC55(1)
                                          <---------ANAC55(2)
                                        --------->ZAT6
                                     ----------->HVH21    --------->ZAT6
         <---------ANAC46        <---------ANAC58    --------->ANAC46      --------->YAB1          <
         <---------ANAC58        <---------ANAC58    --------->ANAC58     <---------YAB1          <-
         <---------ANAC58        <---------ANAC46    --------->ANAC58   --------->YAB5            --
---------->DOF2              <---------ANAC58       <-------TEIL   <---------ARR11(3)             --
--------YAB1                 <---------ANAC58    --------->ZAT2    --------->ARR11(3)             <-
----->YAB1 ----------->GT1   <---------ANAC46    --------->At4g35610   <---------YAB1            ---
 
tataaaagtagagcgtgtaacatgaagtagttgtgtgcgtgtaacacgaaacagctacgtaacacaagaagatgttgattataaactaatagtcttggga  9781600
                                                    <---------GATA12         <---------TOE2(3)
                                                    --------->GATA12         <---------TOE1(3)
                                                   <------ZmHOX2a(1)     <---------WOX13(2)
                                                 <---------TOE2(3)       --------->WOX13(2)
                                             <---------WOX13(2)          <---------AHL12(2)
                                             <---------AHL12(2)         <---------AHL25(3)
                                             --------->WOX13(2)        --------->AHL20(2)
                                            <---------AHL12(1)         <---------AHL20(2)
                                            --------->AHL12(1)         --------->AHL25(1)
                                            <---------AHL25(3)         <---------AHL20(3)
                                            <---------AHL25(2)         --------->AHL20(3)
                                            --------->AHL20(2)         <---------AHL12(3)
                                            --------->AHL20(1)         <---------AHL25(1)
                                            <---------AHL20(2)         --------->AHL25(2)
                                            <---------AHL12(3)         --------->AHL12(1)
                                            --------->AHL25(2)         <---------AHL12(1)
                                            <---------AHL25(1)         --------->AHL25(3)
                                            --------->AHL25(1)         <---------AHL25(2)
                                           <---------AHL25(3)          <---------AHL25(3)
                                           --------->AHL25(3)          <---------AHL20(1)
            <---------AHL12(2)             --------->AHL12(1)         --------->AHL12(3)
            --------->WOX13(2)             --------->AHL12(3)         --------->AHL12(2)
            <---------WOX13(2)             <---------AHL20(2)         <---------AHL12(3)
            --------->AHL12(2)             --------->AHL20(2)         <---------AHL25(2)
           <---------AHL20(2)              <---------AHL12(3)        <---------AHL12(2)
           --------->AHL20(2)              --------->AHL25(1)        --------->AHL12(2)
           <---------AHL25(3)              <---------AHL12(1)       <---------AHL12(3)
           <---------AHL20(3)              --------->AHL25(2)       <---------AHL20(2)
          --------->AHL25(3)               <---------AHL25(1)       <---------AHL20(3)
          --------->AHL20(2)              <---------AHL12(3)        --------->AHL20(3)
          <---------AHL25(1)              <---------AHL25(2)        --------->AHL12(3)
          <---------AHL12(1)              <---------AHL12(2)       --------->AHL25(3)
          --------->AHL25(1)              --------->AHL12(2)       <---------AHL25(3)
          --------->AHL12(1)              --------->AHL12(3)      --------->AHL25(1)
          <---------AHL20(2)              <---------AHL20(3)      --------->AHL12(3)
        <---------WOX13(2)                --------->AHL25(3)      <---------AHL20(2)
        --------->WOX13(2)                --------->AHL25(2)      --------->AHL20(2)
      --------->AHL20(2)                  --------->AHL20(3)      <---------AHL12(3)
      <---------AHL20(2)                 --------->AHL12(2)       <---------AHL25(1)
    <----------DOF2                    <---------AHL20(2)         --------->AHL25(3)
  <---------YAB5                       --------->AHL20(3)      <---------AHL25(3)
--------->YAB1--------->AHL12(1)       <---------AHL20(3)      --------->AHL20(1)
---------YAB1 <---------AHL20(2)       --------->AHL20(2)      <---------AHL20(1)   <---------AHL20(2)
--------AHL25(2)                   --------->HSFB2a(2)        --------->AHL20(2)   --------->AHL25(3)
------->AHL25(2)           <---------ICU4--------->YAB1       <---------AHL12(3)   --------->AHL25(1)
------->AHL20(3)          <---------YAB1 <---------AHL12(2)   --------->AHL12(3)   --------->AHL20(2)
--------AHL20(3)<-----------GT1    <---------HSFB2a(2)------>ZmHOX2a(2)--------->AHL20(1)        <--
------>YAB1--------->AHL20(3)<---------YAB5<---------AHL25(2) --------->AHL25(1)   <---------AHL25(1)
 
ttataatcttttattaatttatcgatatactaattgttctaaaaaaataatttaggatcgaagaaatatataaatttattaaggtattaattcatccaat  9781700
                        ------>MYB46(1)
                      <---------MYB59
            ------>ZmHOX2a(1)
          ------>ZmHOX2a(2)
          ==========================HOX2a_HOX2a
         ===========================HOX2a_HOX2a
         <------ZmHOX2a(2)
        --------->ARR11(3)
        --------->ARR14(2)
        <---------ARR11(3)                                                    --------->ARR11(3)
        <---------ARR14(2)                                                    <---------AHL20(1)
        --------->ARR11(2)                                              --------->YAB1
        --------->GATA12------>MYB83                                --------->ATHB12
        <---------ARR11(2)                                          -------->ATHB1
        <---------GATA12-------->P                                  --------->ATHB51
        <---------GLK1(2)                                          <---------YAB1
        --------->ARR14(3)                                    --------->TOE2(3)        ------>ZmHOX2a(1)
        <---------ARR14(3)                                 <---------GLK1(1)  <---------AHL20(2)
    ---------->DOF2<-----------GT1                     <---------HSFB2a(2)  --------->AHL12(2)
-------YAB1--------->TOE2(3) ------>ZmHOX2a(1)         --------->HSFB2a(2) --------->AHL20(2) ------
 
atgatttcaaagatcctcaatataacctactcctacatgtgactattcaacaaaacgtctggaaacctctattattgataatatatggtcctacatatga  9781800
                                      --------->AHL12(2)
                                      <---------AHL12(2)
                                      <---------WOX13(2)
                                      --------->WOX13(2)
                                    --------->AHL20(3)
                                    <---------AHL20(3)
                                    <---------AHL12(3)
                                    --------->AHL25(1)
                                    --------->AHL25(3)
                                    <---------AHL25(1)
                                    <---------AHL25(3)
                                    <---------AHL25(2)
                                    --------->AHL25(2)
                                    <---------AHL20(2)
                                    <---------AHL12(1)
                                    --------->AHL12(3)
                                    --------->AHL12(1)
                                    <---------AHL20(1)
                                    --------->AHL20(1)
                          -------->ATHB1
                          <--------ATHB1
                          --------->ATHB51
                          <---------ICU4
                         <---------YAB1                                 <----------DOF2
                        --------->WOX13(2)                           --------->ARR11(3)
                        <---------WOX13(2)    <------------CBF       <-----------GT1
                      ------------>ATHB5<---------AHL20(2)           <---------ARR11(3)
                 --------->ANAC58   --------->AHL20(2)              --------->YAB1
                 --------->ANAC58  --------->AHL12(2)              <---------YAB5
              <---------ZAT2       --------->AHL25(3)             --------->AHL12(2)
              <------NtERF2       --------->AHL12(2)              --------->WOX13(2)
              --------->ZAT2      --------->WOX13(2)              <---------AHL12(2)
             ------>NtERF2--------->ATHB12<---------WOX13(2)      <---------AHL20(3)
             --------->ANAC58     <---------WOX13(2)--------->ZAT6--------->AHL20(3)
             --------->ANAC58 ----------->GT1 --------->WOX13(2)  <---------WOX13(2)
         --------->ANAC58<---------ATHB51 --------->WOX13(2)     --------->YAB5                   --
         --------->ANAC58<---------ATHB12<-----------GT1         --------->YAB1                  ---
     ---------->DOF2--------->TOE2(3)<---------AHL25(3)          <---------ICU4                  <--
     --------->AHL20(2)--------------->AGL15  <---------WOX13(2)<---------YAB1                <-----
--->YAB5 --------->ANAC46--------->ICU4 --------->AHL20(2)      --------->ICU4               -------
 
ctattcaataaaacgccagcaagcctcaattattggtaattaattaactaattgaactctacatgtgataattatcttttttttttttttttggattaaa  9781900
                    <---------At4g35610
             <---------ARR11(2)
       ------>ZmHOX2a(2)
       =================HOX2a_HOX2a
      <------ZmHOX2a(2)
      ==================HOX2a_HOX2a
     --------->ARR11(3)
     <---------GATA12
     <---------GLK1(2)
     <---------ARR11(3)
     --------->GATA12           *TSS
     --------->ARR14(2)        <---------DOF5.7(1)
     <---------ARR14(2)   ------------>CBF                                                 ---------
   --------->DOF5.7(1) --------->YAB5                                          <---------At4g35610
   <---------YAB5   --------->At4g35610                                    --------->ARR11(2)
 ---------->DOF2 ------>ZmHOX2a(1)                                     <---------ANAC46    ---------
------->CCA1(2) --------->TOE2(3)                                      <---------ANAC58    ---------
------>ARR11(3) --------->TOE1(2)                                      <---------ANAC58 <---------CCA1(2)
-------ARR11(3) --------->TOE2(2)         --------->MYB52(1)--------->ZAT6 <---------ARR14(2)     --
----TOE2(3)  --------->ARR11(2)--------->YAB5             <-----------GT1  <---------ARR11(2)     <-
--->DOF2    <---------CCA1(2) <---------ATHB12         --------->WOX13(2)  --------->ARR14(2)    <--
 
gatataaagatccttgtatcctaagatgactcaatctttagaaactaagagagaatggaattaacactaaaattgctggttctgcttctgtttatcttaa  9782000
       <------MYB83
       <---------MYB46(3)
       <------MYB46(1)
   <-----------RAV1(1)
 <---------ICU4
<---------YAB5
>YAB1<--------P                                                                   --------->MYB52(2)
>TOE2(3) <---------ARR11(2)          --------->LBD16                            <---------MYB52(1)
>TOE1(3) --------->ARR11(2)         --------->LBD16                           <---------MYB46(3)
------->YAB1                   <---------ANAC58          <----------DOF2      --------->MYB52(2)
--------ICU4         --------->YAB1<---------LBD16  <---------DOF5.7(1)  --------->LBD16   <--------
-------ATHB12   <----------DOF2<---------ANAC58    <---------DOF5.7(1) <---------LBD16    <---------DOF5.7(1)
 
atcatcatgttggttctggctctatcgtcaagtttcttcccggttttgaaggccctcttcctttcgaacttgaaaccgggtttgttagttctctcttttg  9782100
                                --------->KAN1
                               <---------YAB5
                           <---------YAB5                                           --------->KAN1
                           --------->ICU4                                      --------->ZAT18
                          --------->WOX13(2)       <-------TEIL                <---------ZAT18
                          <---------WOX13(2)   --------->DOF5.7(1)        <------ZmHOX2a(1)
                      ----------->GT1        --------->MYB52(1)       --------->DOF5.7(1)
--DOF2            <---------RVE1(2)          ---------->DOF2        <------ZmHOX2a(1)      <--------
 
caacaatgtgttttgagtttggagtttgtaattagtcattcttttgactaaaggtacattggtattggtgaggaagaggaagtgcaattgttctattatt  9782200
                                                                                                   <
                                                                                               -----
                          <---------ARR11(3)                                                  ------
              <---------GATA12                                                          --------->HSFC1(1)
             <---------GLK1(1)                                                          <---------HSFB2a(2)
   <---------GATA12       <---------ARR14(2)                 --------->KAN1             --------->HSFB2a(2)
   --------->GATA12---------->DOF2                    --------->ARR14(2)               -------------
   --------->RVE1(2)      --------->ARR14(2)          <---------ARR14(2)               <---------LBD16
   --------->ARR14(2)     --------->ARR11(3)    --------->ALFIN1                   <----------DOF2 -
   <---------ARR14(2)--------->DOF5.7(1)      <---------ANAC46                    <---------DOF5.7(1)
-YAB1        --------->GLK1(1) <---------DOF5.7(1)   <------ZmHOX2a(1)  --------->ZAT6<-------------
 
tcatcaaatctgagagaaatccaaaagaagaccctcttcttctctggttaagtggaggacctggatgttcttctatcactggccttcttttccagaatgg  9782300
                                                                  <---------AHL12(2)
                                                                  --------->WOX13(2)
                                                                <---------AHL25(1)
                                                                --------->AHL20(2)
                                                                --------->AHL25(1)
                                                                --------->AHL20(1)
                                                                <---------AHL20(2)
                                                                <---------AHL25(3)
                                                                --------->AHL25(3)
                                                                <---------AHL25(2)
                                                                --------->AHL25(2)
                                                                <---------AHL12(1)
                              <---------AHL12(2)                <---------AHL12(3)
                              <---------AHL25(2)                --------->AHL12(1)
                              <---------AHL20(3)               --------->AHL20(2)
                              --------->AHL20(3)       ----------->GT1
                              --------->AHL12(2)       <-------GAMYB
                              --------->AHL25(2)      <------MYB46(1)
                             --------->AHL25(1)       ----------->GT1   --------->ARR11(3)
                             <---------AHL12(1)       <------MYB83<---------WOX13(2)
                             --------->AHL12(1)     --------->ALFIN1    <---------ARR11(3)
                          <------ZmHOX2a(1)      --------->DAG2--------->AHL25(2)
---------GATA12           --------->YAB5        ---------->DOF2<---------AHL12(3)
---->At5g28300          <---------TOE1(3)     <----------DOF2  <---------AHL25(2)
----->GT1               <---------TOE2(3)    <---------ANAC46  --------->AHL12(3)              <----
---->AGL1           <----------DOF2          <---------ANAC58  <---------AHL25(1)    --------->ATHB12
-------->GATA12    <---------ANAC58          <---------ANAC58  --------->AHL25(3) <---------ANAC58 <
----AGL1           <---------ANAC58     <------ZmHOX2a(1)      --------->AHL25(1) <---------ANAC58<-
 
taaatctctattttttgctcttgctttaaggattattttcaaaggattgcttaaagtgggttaaaaaaaaattaagaccttggtttcttgatttcttagg  9782400
<- Previous    Next ->

AGI:  At2g22970.1   
Description:  SCPL11; serine carboxypeptidase. Identical to Serine carboxypeptidase-like 11 precursor (SCPL11) [Arabidopsis Thaliana] (GB:Q2V465;GB:O64807); similar to SCPL9, serine carboxypeptidase [Arabidopsis thaliana] (TAIR:AT2G23010.1); similar to SCPL12, serine carboxypeptidase [Arabidopsis thaliana] (TAIR:AT2G22920.1); similar to SCPL12, serine carboxypeptidase [Arabidopsis thaliana] (TAIR:AT2G22920.2); similar to 1-O-acylglucose:anthocyanin-O-acyltransferase [Clitoria ternatea] (GB:BAF99695.1); contains InterPro domain Peptidase S10, serine carboxypeptidase; (InterPro:IPR001563)
Range:  from: 9781933    to: 9785608    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version