AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                 <-----------GT1                           --------->GLK1(2)
              <---------ICU4                              <---------RVE1(2)
             <---------YAB5                 <---------AHL12(1)
            <---------WOX13(2)              --------->KAN1--------->ARR14(2)
            --------->WOX13(2)              --------->AHL12(1)    --------->TOE2(3)        ---------
         ------>ZmHOX2a(1)          <----------DOF2       <---------GLK1(2)             ----------->RAV1(1)
---------------AtSPL8              <---------ANAC58       <---------ARR14(2)     --------->DAG2
-------------->AtSPL8              <---------ANAC58       --------->GATA12       --------->DOF5.7(1)
---YAB5 --------->TOE1(3)     <------ZmHOX2a(1)     <----------DOF2             ---------->DOF2
>YAB1   --------->TOE2(3)    <---------YAB1--------->ARR14(2)    --------->REM1(1)     --------->REM1(1)
 
tttgagtacttccttaattgttacatttcactaggattgctttccaaatattcaactttcagattcttacatcaatatgttgaaaaagctacaccagtaa  9702600
                                                           <---------AHL20(2)
                                                           --------->AHL12(3)
                                                           <---------AHL25(1)
                                                           <---------AHL12(1)
                                                           --------->AHL12(1)
                                                           <---------AHL12(3)
                                                          <---------AHL20(1)
                                                          --------->AHL20(1)
                                                          --------->AHL25(3)                  <-----
                                                         --------->AHL12(2)                   ------
                                                         <---------AHL12(2)                   ------
                                                         --------->AHL12(3)                 <-------
                                                         <---------AHL12(3)                 <-------
                                                        --------->AHL20(1)                  --------
                                                        <---------AHL25(3)           --------->ANAC58
                                                        <---------AHL20(1)           --------->ANAC46
                                                       --------->AHL25(1)            --------->ANAC58
                                                       <---------AHL12(3)           --------->ZAT18
                                                ----------->GT1      <---------ARR11(3)    ---------
                                           --------->AHL20(2)--------->AHL12(2)   --------->ZAT18
                                         <---------------AGL15       --------->ARR11(3)    ---------
                                  --------->ARR11(3)   --------->AHL20(2)         <---------ZAT14
                                  <---------ARR11(3)   --------->AHL12(1)         <---------ZAT18
                                  <---------GATA12     --------->AHL12(3)  <---------AHL20(2)-------
    <-------TEIL      <---------GATA12   --------------->AGL15 <---------AHL20(2) --------->ZAT14
-->GT1       --------->MYB52(1)   <---------RVE1(2)    <---------AHL12(1)  --------->AHL20(2)-------
 
aactagtttcatgggctaactgataaatctcacaatagattttagtttatatagtaaaatatatattttataaatcttttaaatgtgcacacaaaaaaat  9702700
                        <---------AHL25(3)
                        --------->AHL25(2)
                        <---------AHL20(2)
                        --------->AHL20(2)
                        <---------AHL12(3)
                        --------->AHL20(3)
                        --------->AHL25(1)
                        <---------AHL20(3)
                        --------->AHL12(3)
                       <---------AHL25(3)
                       --------->AHL25(1)
                       <---------AHL25(1)
                       <---------AHL25(2)
                       --------->AHL25(3)
                       <---------AHL12(3)
                       --------->AHL12(3)
                       --------->AHL12(1)
                       <---------AHL12(1)
                       --------->AHL20(2)
                       <---------AHL20(2)
                       --------->AHL25(2)
                      --------->AHL25(3)
--------->AHL20(2)    <---------AHL25(2)                                      --------->STY1(2)
<---------AHL20(2)    <---------AHL12(3)                                      <---------STY1(2)
----ARR11(3)          --------->AHL12(1)                                     ------>MYB46(1)
--->GLK1(2)           --------->AHL12(3)                             <---------AHL25(3)
--->ARR11(3)          <---------AHL12(1)                             --------->AHL20(2)
--AHL25(3)           --------->AHL12(2)                              <---------AHL25(1)
--AHL12(1)      --------->At4g35610                                --------->WOX13(2)
->AHL12(1)      <---------At4g35610                                <---------WOX13(2)
>AHL20(2)<---------WOX13(2)                                      --------->AHL20(2)
>AHL20(3)--------->WOX13(2)                             ----------->GT1      ------>MYB83        <--
-->CCA1(1)   <---------At5g28300              --------->KAN1     <---------AHL20(2)  --------->DAG2
-->RVE1(1)  <-----------GT1                   --------->ICU4    --------->AHL20(2)  ---------->DOF2
 
cttttaaatgtgaatttacagctaaatttttttaaaaacatttgctgtaatattcagaagtgtaattttaaattaaaacctagctagtaaagtaatagtc  9702800
                                                                                                ----
                  <-----------GT1                                     <----------DOF2           <---
               <---------DOF5.7(1)                              <---------ANAC55(2)            -----
          <-----------GT1                                       --------->ANAC58               -----
        --------->WOX13(2)                                      <---------ANAC58               <----
        <---------WOX13(2)                                      <---------ANAC58               =====
      <---------AHL20(2)                                        --------->ANAC46               -----
      --------->AHL25(3)                                        --------->ANAC55(2)            <----
     <---------AHL12(3)                            --------->YAB5<---------MYB59               <----
     <---------AHL20(3)                           --------->ICU4--------->ANAC58               -----
     --------->AHL20(3)                       ------------>CBF  --------->ANAC55(1)            <----
     <---------AHL20(2)                      --------->ANAC58   <---------ANAC55(1)        ---------
     --------->AHL20(2)                  --------->AHL12(1)--------->ATHB51              --------->AHL12(3)
     <---------AHL25(1)                  --------->KAN1    <--------HAHB4                <---------AHL25(1)
     --------->AHL25(1)                --------->AHL12(2)  <---------ICU4                --------->AHL25(1)
     --------->AHL25(3)                <---------AHL12(2) --------->ICU4                 --------->AHL20(2)
     <---------AHL25(2)               <---------AHL20(2)  <---------YAB1                 <---------AHL20(2)
-------REM1(2)<----------DOF2--------->ANAC46--------->ANAC58 <-----------GT1            --------->AHL25(3)
 
tacacgattttaatttccttttatccacttcaacgtaatattaaaaattcgcaatgtttccattattacgtaactttctaaactcgtttcatataatttc  9702900
                                                              <---------DOF5.7(1)
                                                         --------->YAB1
                                                         <---------ICU4
                                                       <---------AHL12(2)
                                                       --------->AHL12(2)
       ----------->GT1                                --------->YAB1
      <-------TEIL                               <---------AHL20(3)
   <---------MYB46(3)                            <---------AHL20(2)
<------------CBF                                 --------->AHL20(3)
----------->AGL15                                <---------YAB1<----------DOF2
------------AGL15                                --------->AHL25(3)
------------>AGL1                                --------->AHL20(2)
------------>AGL2                               --------->AHL12(2)
-------------AG                   <---------GLK1(2) <---------YAB1
======================================================================================MADS_MADS
------------>AG              <---------RVE1(2)  <---------AHL12(2)                                 -
-------------AGL1        <------------CBF     <---------ARR11(3)                         --------->YAB1
-------------AGL2    --------->ANAC58         <---------AHL20(1)              --------->At4g35610  -
------------>AGL3    --------->ANAC58         --------->AHL20(1)              <---------At4g35610  <
-------------AGL3--------->RVE1(2)<---------RVE1(2)--------->AHL12(2) --------------->AGL15---------
>WOX13(2)     --------->YAB1--------->ATHB12  --------->AHL20(2)   <-----------GT1      <---------YAB1
 
caaaattggttcgtaaatcatatcaagaaattgatttgattctccactatatattattaataatctcttttgaccagttttagctaaaactataatacta  9703000
                                        <---------TGA1a
                                     <---------ZAT18
                                     --------->ZAT18
                               --------->WOX13(2)
                               <---------WOX13(2)
                              <---------ICU4
                              --------->YAB5
                              --------->YAB1
                              --------->ATHB51
                              <--------HAHB4
                              --------->ATHB12
                             --------->AHL25(3)             =======================HOX2a_HOX2a
                             <---------AHL12(1)             ====================HOX2a_HOX2a
                             --------->AHL12(1)             <------ZmHOX2a(2)
            <---------YAB5   --------->AHL25(1)            --------->ARR11(2)
           ------->TEIL   <------NtERF2 --------->TGA1a    --------->RVE1(2)
   ===============================================bZIP_DOF --------->GATA12                 <-------
   ---------->DOF2       --------->LBD16<---------O2       <---------GATA12        ------->TEIL
 XXXXXXXXXXXXXXXXXXXX>MIR169D-G<---------AHL12(2)          --------->AGP1   ------>ZmHOX2a(1)
-------->ANAC58        <---------LBD16<---------ALFIN1     <---------ARR14(2)   ----------->HVH21
-------->ANAC58<---------YAB5--------->ICU4                <---------ARR11(2)  --------->LBD16  ----
----------ID1--------->YAB1  <---------KAN1   ----------->RAV1(1)        ------>ZmHOX2a(1)  --------
>ZAT6--------->DOF5.7(1)--------->LBD16 --------->O2       --------->ARR14(2) <---------ANAC46<-----
 
agaagccaaagatgaatcatcgtctcgccggaataattagcccacttggccacattactacagatccaattcgttcctcctccgtgaacccttcgtctcc  9703100
                                                                                         --------->GATA12
                                                                                         <---------ARR14(2)
                                                                             =======================HOX2a_HOX2a
                                                                             ------>ZmHOX2a(2)
                                                                            <------ZmHOX2a(2)
                                                                           <---------GATA12
                                                                           --------->ARR11(3)
                                                      --------->ZAT2       <---------ARR11(3)
                                                      <---------ZAT2       --------->GATA12
                                                      <---------At4g35610 <---------GLK1(1)
                                            --------->MYB46(3)       --------->YAB1      --------->ARR14(2)
                               --------->TOE2(3)      ----------->RAV1(2) --------->GLK1(1)  ------>ZmHOX2a(1)
                             --------->RVE1(2)    <-----------HVH21 <---------ATHB12     --------->ARR11(2)
                             --------->GATA12   <-------MYC3       ------>MYB46(1) <---------MYB46(3)
--ARR11(2)                   <---------GATA12   ------->MYC3       ------>MYB83  <---------At4g35610
----->LBD16                 <---------CCA1(2)  --------->O2       --------->WOX13(1) <---------MYB52(1)
->ARR11(2)          <---------YAB5        --------->ARR11(2)<---------ANAC58<---------GLK1(1)=======
----LBD16         <-----------GT1       <---------MYB52(1)  <---------ANAC58========================HOX2a_HOX2a
 
ggtttactacaaaaccattgttaaccatttcaaatctcaaaccggtaaccacgtttcacctgggcttaccaatcaagagatctcagccgttgaatcctct  9703200
                                                     <------MYB46(1)
                                                     <---------DEAR3(2)
                                                     <------MYB83                     --------->ARR11(2)
                                                    --------------->AtSPL8            <---------ARR11(2)
                                                    --------->MYB55(2)                <---------ARR14(2)
                                                    --------->MYB46(2)               <---------SPL7(1)
                             <---------RVE1(2)      --------->MYB111(1)     <---------ARR14(2)   <--
                             <---------GLK1(2)      <---------MYB46(3)      <---------ARR11(2)------
                    ------>ZmHOX2a(2)               --------->MYB111(2)     --------->ARR11(2)------
                   <---------GLK1(1)                <---------AtMYB61      <---------SPL7(1)  <-----
                  --------->GATA12                 <---------MYB55(1)     <---------ANAC58    <-----
                  <---------ARR11(3)               <--------P             <---------ANAC58   <------
                  <---------GATA12                <-------GAMYB      <---------WOX13(2)   --------->LBD16
       <----------DOF2  <---------SPL7(1)         <---------MYB52(1) --------->WOX13(2) <---------LBD16
      <---------DOF5.7(1)<---------MYB52(1)    <---------LBD16  <-----------GT1   <-----------HVH21
===========================HOX2a_HOX2a       <---------SPL7(1) <-----------GT1  --------->LBD16-----
 
catggtttctctttccctcttgatctccgttcgattctccaaaccggtcttccggttggtaccaattttcccaattggcgaaccgggtcgaaccggaata  9703300
                                                                                 ----------->TGA1
                                                                                 ----------->HVH21
                                                                              <---------ARR11(2)
                                                                              <---------ARR14(2)
                                                                              --------->ARR14(2)
                                                                            --------->LBD16
                                                                           --------->ANAC58
                                                                           --------->ANAC58
                                                                      ----------->HVH21
                                                                      <---------ETT(1)
                                                                     --------->DEAR3(2)
                                                                     ------>ZmHOX2a(2)
                                                                    <------ZmHOX2a(2)
                                                                   --------->GATA12               --
                                  <-----------TGA1                 <---------GATA12     <------NtERF2
                                  <-----------HVH21                --------->ARR14(2)  --------->LBD16
-------YAB5                      --------->ETT(2)                  --------->ARR11(2) --------->ALFIN1
--->KAN1                      --------->ANAC46--------->GLK1(2)    <---------ARR14(2) <----------CDC5
--->KAN4(1)                   <---------O2   <---------GLK1(2)     <---------ARR11(2)<---------LBD16
----KAN1                      --------->O2   <---------RVE1(2)<---------LBD16 --------->ARR11(2)<---
----KAN4(1)                <---------REM1(2) --------->ARR14(2)   --------->GLK1(1) <---------ANAC46
---KAN4(2)<---------DOF5.7(1) --------->bZIP60(2)       <---------GLK1(2) <---------LBD16    <------
---->YAB1<---------DOF5.7(1)<---------ALFIN1 <---------ARR14(2)   <---------GLK1(1) <---------bZIP60(2)
 
atcttcttctccctcttcttaatctgtctcaacacgtcgtcagaaatggattctgggtcgattcttgggggatccgacccggaaatgacgcggaggcttt  9703400
                                                                                       <------NtERF2
                                                                                     <---------ANAC58
                                                                                     >>>>>>>>>>E2Fa
                                                                                     <---------ANAC58
                                                                                     <---------ANAC46
                                                                                    <---------LBD16
                                                                                    <<<<<<<<<E2Fd
                                                                          ------>NtERF2<<<<<<<<<<E2Fb
                                                                         --------->ANAC58
                                                                         --------->ANAC58  ---------
                                                           --------->ANAC55(2) <---------ARR14(2)
                               --------->KAN1  --------->ANAC46        ------>NtERF2<<<<<<<<<E2Fc
                             --------->LBD16--------->ARR11(2)         <---------ATERF1(1) <--------
                       ------>ZmHOX2a(2)    <---------ARR11(2)        <---------DEAR3(1)   <--------
                      <------ZmHOX2a(2)     <---------ZAT14<---------ANAC58    --------->ARR14(2)
                     <---------GATA12       --------->ZAT14<---------ANAC58<-----------------AGL3
                     --------->GATA12       <---------ARR14(2)        --------->ANAC46--------->LBD16
------->KAN1    <---------WOX13(1)<---------YAB5           --------->ANAC46----------------->AGL3
--------HVH21 --------->ATHB12<---------MYB52(1)         <-----------GT1 --------->ANAC46 --------->GLK1(1)
----DOF2 --------->ARR11(3)<---------LBD16  --------->ARR14(2)        --------->DEAR3(1)  <---------GLK1(1)
 
gtcactcgtgaagaaattgattgagatcgctccggtactcgtccctgtatacggcgatttttacgtcccttcgacgacgccaaatttggcgggaaatcca  9703500
<- Previous    Next ->

AGI:  At2g22790.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G67020.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO17740.1)
Range:  from: 9703012    to: 9703989    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version