AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                    --------->MYB52(1)
                    ------>MYB83
                    ------>MYB46(1)
                   --------->MYB55(1)
                  --------->AtMYB61
           --------->YAB1
           --------->YAB5                                                                         --
          <---------YAB1                                                                         <--
          --------->ICU4                                                                      <-----
          <---------ATHB12--------->KAN1                                                      ------
      XXXXXXXXXXXXXXXXXXXX>MIR418 --------->KAN1                                      ---------->DOF2
     --------->ANAC46 --------->ANAC46                                           --------->YAB1  <--
     --------->ANAC58 --------->ANAC58                 --------->ZAT14          <-------TEIL  <-----
     --------->ANAC58 --------->ANAC58                 <---------ZAT14       --------->KAN1   ------
-->ZmHOX2a(1)  <-----------GT1 <----------DOF2   --------->RVE1(2)    <-----------GT1 ==============
 
ttgtataaacgcaatgataaaccaaacgcaaatgcttttattccaaactcaaaatcagtgaacagacattttctcaccatacattcatagaaagctatat  9290400
                            <------NtERF2
                          <---------WRKY12
                        <-----------HVH21
                        <-----------TGA1
                       ===============================================bZIP_DOF      <---------GLK1(1)
                       --------->TGA1a                                            <------NtERF2
                       --------->TGA2(1)                                         --------->LBD16
         <---------YAB1<---------TGA2(1)                                       <---------LBD16
    --------->YAB5     --------->bZIP60(1)                                   ------->GAMYB
    <---------ICU4     --------->ANAC58                                      --------->DEAR3(1)
   <---------YAB5      <---------bZIP60(1)                                  --------->DEAR3(2)
 <-----------GT1       <---------TGA1a                                      --------->MYB46(3)
------->YAB1           --------->ANAC46                                   --------->ARR14(2)
-------AHL20(2)        --------->O2 <---------KAN1                        <---------ARR11(2)
----AHL20(1)           --------->ANAC55(2)                      --------->At4g35610 --------->GLK1(1)
--->AHL20(1)           <---------ANAC55(2)                      --------->ZAT2--------->MYB52(1)
-------YAB1<---------ICU4--------->TGA2(2)           <-----------RAV1(2)  --------->ARR11(2)
----ARR11(3)           --------->ANAC58    --------->YAB1    --------->DOF5.7(1)--------->DEAR3(1)
--->AHL20(2)  --------->ARR11(3) <------ZmHOX2a(1)----------->HVH21     ----------->ARR10 <---------RVE1(2)
=================================bZIP_DOF <---------YAB1   ---------->DOF2<---------ARR14(2) <------
 
attataaccattactaatgtcttcttacgtcagcgaggaacatttatcaaagtttgacaggggaaagagctggagaagaaccgccggagttcggagattg  9290500
                                                                   --------->ATHB12
                                                             ----------->RAV1(1)
                                                          <------NtERF2
                                                         <---------ATERF1(1)
                                                         --------->ORA47(1)
                                                         --------->LBD16
                                                         ------>NtERF2
                                                        --------->DEAR3(1)                      ----
                                                        <---------ATERF1(2)                    <----
                                                        --------->ATERF1(2)                    -----
                                  --------->ANAC58     --------->ATERF1(1)     <---------bZIP60(1)
                 <---------MYB46(3)                    <---------LBD16<---------ZAT6     <-------GAMYB
      --------->ANAC46            --------->ANAC58   --------->DEAR3(1)        --------->bZIP60(1)--
     <---------LBD16            ---------->DOF2  <---------YAB5--------->MYB46(3)       <---------DEAR3(1)
   --------->MYB46(3)   ------>ZmHOX2a(1)       --------->ANAC58  <---------ATHB12    ------->GAMYB<
---WOX13(1)<------ZmHOX2a(1) <---------ZAT6     --------->ANAC58--------->WOX13(1) --------->MYB52(1)
 
acagaaaccacggaggacattggtttcctccagtgtaaagccaagagaagtaagcatcgccggccaacaatcagtggtaatgacatcaacggcgttgcag  9290600
             <------MYB46(1)                                              --------->ZAT18
            <---------AtMYB61                                             <---------ZAT18
   <---------ARR11(2)                           <---------ICU4         <---------ANAC46
   --------->ARR11(2)                     <------ZmHOX2a(2)            <---------ANAC58
------->GAMYB<------MYB83     --------->DOF5.7(1)                      <---------ANAC58
----->MYB46(3)         <---------MYB52(1)<---------GATA12      --------->ZAT2
-----At4g35610        <-------GAMYB      --------->ARR11(3)    <---------At4g35610
---->At4g35610   ----------->HVH21       <---------ARR11(3)    --------->At4g35610   --------->ANAC46
------>P    --------->MYB59 ---------->DOF2------>ZmHOX2a(2)   <---------ZAT2      <---------ALFIN1
------------AtMYB77<---------At5g28300<---------KAN4(2)   <---------bZIP60(1)      --------->ZAT6---
 
caaccgtagccgagtttggtctcaccgttgagaaagaagagaacgatctcattagtacatgacttcagctcgtagagtgcatcccaacactgcatcagtc  9290700
                                            <------NtERF2
                                          <---------ANAC58
                                      <---------TGA1a
                                      --------->TGA1a
                                     ------>NtERF2
                                  ------>NtERF2
                                 --------->ANAC58
                                 --------->ANAC46
                              <---------GATA12
                              --------->GATA12
                              <---------ARR14(2)
                              <---------ARR11(2) <---------ZAT18
                              --------->ARR14(2) --------->ZAT14
                              --------->ARR11(2) --------->ZAT18                               -----
                        <------MYB46(1)------->PIF5                                      -----------
                        <---------MYB46(3)<---------ANAC46                              --------->At5g28300
     ===========================================MYC_MYB                                ----------->GT1
     <--------P--------->ANAC46  --------->ANAC58<---------ZAT14                      <---------ANAC46
     <---------MYB52(1) <------MYB83--------->DEAR3(1)--------->ZAT2                  <---------DEAR3(1)
    <---------MYB52(1) <---------AtMYB61  <---------ANAC58                          --------->MYB52(1)
   --------->LBD16  <-----------RAV1(1)<-------PIF5   <---------At4g35610          ----------->TGA1<
 <---------LBD16<---------RAP2.6(3) <---------ALFIN1  --------->At4g35610          ----------->HVH21
------>ZmHOX2a(1)<---------MYB52(1)----------->HVH21  <---------ZAT2           --------->DOF5.7(1)--
--->ZmHOX2a(1) --------->RAP2.6(2)<-----------HVH21  <-----------RAV1(1)   <------ZmHOX2a(1) -------
 
ctcctccggttagtctagccgctatgttggtggaatccgccacgggcgggagtgctctgctggagacgttgagaacgaggagaagagtgacggtgacaaa  9290800
                                                                                --------->At4g35610
                                                                                <---------At4g35610
                                                                             --------->DOF5.7(1)
                                                     <---------ANAC46    <------MYB46(1)
                                                     <---------ANAC58    <------MYB83
                                           <-----------RAV1(1)       <---------ARR11(2)
                                     <---------ARR14(2)              --------->ARR11(2)
                                     <---------GLK1(2)               <---------ARR14(2)
                                     --------->ARR14(3)              --------->GATA12
               >>>>>>>>>>>>>>>>>LFY  <---------RVE1(2)               --------->ARR14(2)            <
---->DOF5.7(1)--------->ANAC58       <---------ARR14(3)              <---------RVE1(2)      --------
>HVH21 <---------ZAT6                <---------GATA12<---------ANAC58<---------GATA12      <--------
------ZmHOX2a(1)             <----------DOF2     <------------CBF   <------ZmHOX2a(1)    --------->YAB1
--------->GT1 --------->ANAC58       <---------ARR11(3)   <---------AtMYB61  ----------->ARR10   ---
--->DOF2      --------->ANAC46       --------->ARR11(3)----------->HVH21--------->MYB59<-----------TBP
 
gaggaaacttgtgttagaagccattgtgttttcttttgaagattttgtgttgtattgtgtgatggtttagaggatttggtaagagctgctatttataata  9290900
                                   ---------->DOF2
                                 <---------YAB1
                               --------->ATHB12
                               --------->YAB5
                              <---------YAB1
                            -------->HAHB4                                                   -------
                            <---------ICU4                                                   <------
                           --------->ICU4----------->GT1                                     -------
                          --------->WOX13(2)                                     --------->ATHB12
                          <---------WOX13(2)                                     <---------ICU4
            <---------ARR11(3)<---------YAB5                                    <---------ATHB12
           <------ZmHOX2a(1)--------->YAB1                                      <---------YAB5
  <---------YAB1        <---------AHL20(2)                                      <---------YAB1 -----
  --------->ICU4        --------->AHL20(2)                                      --------->ICU4 -----
--------->YAB5     <---------TOE2(3) --------->DOF5.7(1)               <------NtERF2         <------
---------YAB1<---------KAN1<---------ATHB51                         --------->ZAT18   <-----------GT1
->YAB1 ---------->DOF2  --------->AHL25(1)                     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
-YAB1<---------YAB1<---------TOE1(3)<---------TOE2(3)      --------->ALFIN1    <---------TOE2(3)
-------->GT1--------->ARR11(3)--------->ICU4           <------ZmHOX2a(1)  <---------ZAT6    <-------
 
ctgtgattatgaaaggatttttgaggtttaattatgattaaagatggtttttagtggaggaagtgggagagggcagagagttaatgattttacttaaatc  9291000
                                                                             <---------AHL20(3)
                                                                           --------------->AGL15
                                                                           <---------------AGL15
                                                                          <-----------------AGL3
                                                                      --------->ANAC55(2)
       ------->TEIL                                                   <---------ANAC55(2)
    ----------->GT1  <---------WOX13(1)                               <---------ANAC58
    --------->ANAC55(2)                                          ----------->GT1
    <---------ANAC55(2)                            --------->ANAC46   <---------ANAC58
 <---------ATHB12   <------------CBF               --------->ANAC58  <-----------------------TaNAC69(2)
-->GATA12          --------->YAB5                  --------->ANAC58  --------->MYB52(2)
---GATA12          --------->ATHB12             <-------TEIL     --------->YAB5
-->ARR11(3)        <--------ATHB1              --------->CCA1(2) <---------MYB46(3)
---->TOE2(3)      --------->ICU4            --------->DOF5.7(1) <---------ATHB12             <------
---->TOE1(3)      <---------YAB1          ---------->DOF2    <---------WRKY12<---------AHL12(3)  ---
---ARR11(3)       <---------KAN1        ------->GAMYB        <---------WRKY38(1)        <----------DOF2
--CCA1(2)         <---------YAB5     --------->MYB52(1)     ------------>CBF --------->AHL20(3)<----
 
ttaaatcatgtaacttagagaatgattgaataggtggtcttaacggaaagatacaagcgaagagtcaatggttacttgataaatatagaaactttgaaga  9291100
                                                                                            <-------
                                                                                   <---------ARR11(3)
                                                       ----------->RAV1(2)     --------->ANAC58   --
                                                       <---------ZAT2          --------->ANAC58<----
                         <---------MYB46(3)            --------->ZAT2   <---------ZAT2      --------
---YAB1   --------->ALFIN1 <--------P               ----------->HVH21   <---------At4g35610<--------
-------->GT1   --------->At5g28300              <------NtERF2           --------->At4g35610<--------
--------CBF  *TSS        --------->MYB55(2)  ------>NtERF2              --------->ZAT2   --------->YAB1
 
ttgtataacaagagtggctgtaatacagtggttagtattctacgttgaggccgaagggacctgggctcgattcccagcagacacactatctttcatcata  9291200
                                    ------>MYB83
                                    --------->MYB52(1)
                                    ------>MYB46(1)
                                   ----------->HVH21
                                   --------->MYB55(1)
                                  <---------MYB111(1)
                                  <---------MYB46(2)
                                  --------->MYB46(3)
                                  <---------MYB55(2)
                                  <---------MYB111(2)                                           <---
                                  <---------MYB59                                            <------
--ICU4                            <---------MYB52(2)                                        <-------
------->ARR11(3)                 <---------At4g35610                                        <-------
-----ICU4         <-------TEIL   --------->ANAC46                   --------->ALFIN1        <-------
->YAB1    <---------DAG2         --------->ANAC58               <-----------RAV1(2)       --------->At4g35610
-YAB5     <----------DOF2        --------->ANAC58              <-------TEIL               <---------At4g35610
-YAB1  <---------ALFIN1         ------->TEIL           ----------->HVH21           ---------->DOF2 <
 
atgtcttccaacacttttagcttcatccacttatgcacctaacgcttcttctctctatatgacacatacaggtggacacatagagggaaagtcagctttt  9291300
<- Previous    Next ->

AGI:  At2g21750.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G21740.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71715.1); contains InterPro domain Protein of unknown function DUF1278 (InterPro:IPR010701)
Range:  from: 9290447    to: 9290824    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g21760.1   
Description:  pre-tRNA. tRNA-Leu (anticodon: GAG)
Range:  from: 9291114    to: 9291185    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version