AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                               <---------AHL12(1)
                               --------->AHL12(1)
                              <---------AHL12(2)
                              <---------AHL25(1)
                              --------->AHL12(3)
                              --------->AHL20(2)
                       ----------->GT1
                      --------->TOE2(3)
       ------->TEIL   --------->TOE1(3)                                                           --
 ------->TEIL        ----------->RAV1(2)                                            ------>ZmHOX2a(1)
--------ANAC55(2)    ===========================RAV                         --------->GLK1(2)   ----
------->ANAC55(2)   -------->P--------->AHL25(2)                           <---------GLK1(2) <------
---->ARR14(2)      ------->GAMYB --------->RVE1(2)                         <---------GATA12  -------
-----ARR14(2)     <---------MYB111(2)  ------->GAMYB                      --------->KAN1    <-------
-----RVE1(2)      <---------MYB55(2)--------->MYB52(1)               --------->ARR11(2) <---------YAB5
-----ARR11(2)     --------->MYB46(3)----------->RAV1(1)          <---------YAB5    --------->TOE2(3)
---->ARR11(2)    XXXXXXXXXXXXXXXXXXX>MIR773B*                 --------->AHL20(2)   --------->TOE1(3)
 
tatgtatttgaacctttggcaacaacctgaaaaaaaaatcaacagaagtatgagaaacaatctcattaaacatatacagattccatccttaagcatcggg  8758600
      --------------->AGL15                                     <---------WOX13(2)
      <---------------AGL15                                     --------->WOX13(2)
--------->GT1  --------->ARR11(2)                      --------->ARR11(3)
------>DOF2   <-------GAMYB                       <----------DOF2     --------->TOE2(3)
---HSFB2a(2) ----------->GT1            <-------TEIL   <---------ARR11(3)        <-----------GT1
-->HSFB2a(2)--------->MYB59     ----------->RAV1(2)   <---------CCA1(2)    --------->MYB46(3)
--LBD16 --------->KAN1      <---------DOF5.7(1)  <---------DOF5.7(1)  --------->TOE1(3)           --
 
aaagtataactaaattcggttatacataccgtcttccctgaggtacattggacctttatatcttctccattaacctcaacaacttcaccatctatccatg  8758700
               --------->MYB46(3)
              --------->ANAC46                                              <---------ANAC55(2)
              --------->ANAC58                                          <---------WOX13(2)
        ------>ZmHOX2a(2)                                               --------->WOX13(2)
      <---------AGP1                                                  --------->AHL20(2)
      <---------ARR11(3)                                             <---------ATHB12
      --------->ARR11(3)                                            ------>MYB46(1)
      <---------GATA12                                              ------>MYB83
      --------->GATA12                                             --------->WOX13(1)
      <---------ARR14(2)                                       --------->AtMYB61
      --------->ARR14(2)                                       ------->GAMYB--------->ANAC55(2)
      <---------RVE1(2)                                       --------->MYB46(3)
      <---------ARR11(2)                                      <---------MYB55(2)          --------->AHL20(3)
      --------->ARR11(2)                        --------->ANAC58  --------->AtMYB61       --------->AHL12(3)
     <---------CCA1(2)                        <---------KAN1 -------->P--------->WOX13(1) <---------AHL20(3)
   --------->HSFB2a(2)           --------->TOE1(3)          ------->GAMYB --------->AHL20(2)
  <---------LBD16   --------->KAN1--------->DOF5.7(2)      --------->MYB46(3)             <---------AHL12(3)
 ==============HOX2a_HOX2a       --------->TOE2(3)         <---------MYB111(2)          <---------YAB1
 ------>ZmHOX2a(1) <---------ATHB12   --------->ZAT6       <---------MYB55(2)        <---------AHL20(2)
---->NtERF2   --------->ANAC58   <----------DOF2--------->ANAC58  --------->MYB46(3)--------->AHL20(2)
 
cctcctctggatcttgcacccaaacaatcgagccaactttaactgtagaacaagcctgaacaacaaccaccaatcaattacataccattttataaatata  8758800
                                                                                           ---------
                    <------ZmHOX2a(1)                                           --------->ANAC46
                 --------->At4g35610                                          ----------->RAV1(1)
                 <---------At4g35610                                       --------->ANAC46<--------
             <-----------HVH21                                             --------->PCF2 <---------GLK1(1)
    --------->HSFB2a(2)                                            <---------ARR11(3)    <---------RVE1(2)
 
aaaacttctcaaactatgtgagaggacagaaacagcattcaatagtctagtttagagtcttatggtccaagaactaagaccccacaaaatttgatatctg  8758900
                         --------->ANAC46
                         --------->ANAC58
                     <---------YAB1                                                     <---------AHL20(2)
                --------->YAB1                                                          <---------AHL25(3)
                <-----------GT1                                                        --------->AHL25(3)
             <---------ICU4                                                            <---------AHL25(3)
             --------->YAB5                                                            --------->AHL25(1)
             --------->YAB1                                                            --------->AHL20(2)
          --------->YAB1 --------->ANAC58                                              <---------AHL25(1)
         <---------AHL20(2)                                                            <---------AHL20(3)
        <---------AHL20(2)                                                           --------->WOX13(2)
        --------->AHL25(1)                                                          <--------HAHB4
        <---------AHL25(1)                                                          <---------ICU4
        <---------AHL25(2)                                                          --------->YAB5
        --------->AHL20(3)                                                         <---------YAB1
        <---------AHL20(3)                                                         --------->ICU4
        --------->AHL20(2)                    ---------->DOF2                      <---------KAN1
        --------->AHL25(2)    --------->MYB46(3)                          ------->GAMYB<---------AHL20(2)
        --------->AHL25(3)    <---------MYB52(2)                          ----------->RAV1(1)
      --------->GLK1(2)---------->DOF2     --------->TOE1(3)             --------->ANAC46
>ARR11(3)<---------AHL25(3) ----------->RAV1(1)   --------->ARR11(3)     --------->MYB46(3)
-ARR11(3)--------->AHL20(2)<----------ID1  --------->TOE2(3)        --------->RVE1(2)<---------WOX13(2)
 
aatatagagaatttaataataaccatgaaagcaacaaatgagaaaaccttaaagaccatgttcaatctctgtatcaacgacagagcataattaaatgaaa  8759000
                                                                     ----------->RAV1(1)
                                                                 --------->REM1(1)
                                                                 --------->MYB46(3)
                 --------->ANAC46                              ----------->RAV1(1)
               --------->ANAC58                           <---------MYB52(1)
               --------->ANAC46                         <---------ANAC58
               --------->ANAC58                         <---------ANAC58            <----------DOF2
     --------->ANAC58                  ---------->DOF2  <---------ANAC46      --------->YAB1
     --------->ANAC58              --------->RVE1(2)  <---------At5g28300   --------->RVE1(2)     --
 
cccagaagaagcaaacacacacaaaatttggaagaaagtatcaaaagttaacacatttgccgtttgcaacaacaacaaaaatcaaaactttaagtaaaac  8759100
             ------------>CBF
            <<<<<<<<<<<<<<<<<LFY
         --------->ANAC46
         --------->ANAC58
         --------->ANAC58
      --------->ARR11(2)                            --------------->AtSPL8
    --------->ANAC58                                <---------------AtSPL8               --------->ANAC58
    --------->ANAC58            <---------MYB46(3)  --------------->AtSPL3  ------->TEIL --------->ANAC58
  ---------->DOF2            ----------->GT1       ---------->DOF2     --------->At4g35610--------->TOE1(2)
--------->ANAC58        <---------AHL20(2)       <---------AHL20(2) --------->LBD16    --------->GLK1(1)
--------->ANAC58        <---------AHL25(3)      --------->AHL20(2)<---------LBD16  --------->YAB1
------->MYB52(1)       --------->AHL20(2) --------->LBD16       <-----------GT1  --------->RVE1(2)
 
aaaacgaaagaaacgctacaatggaattaaaacggttgataaacccagaaatttaaaagtaccattttcaccggagatgaatcaaatcagaaacccaaga  8759200
                      --------->YAB5
                     <---------YAB5                                                               --
                     <---------KAN1                                                   --------->ARR11(2)
            ----------->RAV1(1) <---------ANAC58                                      <---------ARR14(2)
           <----------ID1       <---------ANAC58                                      <---------GLK1(2)
      ------>ZmHOX2a(1)--------->WOX13(1)                                             --------->ARR14(2)
 <---------GLK1(2)  --------->GLK1(2)                                                <------ZmHOX2a(1)
--------->KAN1 ---------->DOF2  <---------ANAC46   ------------>CBF             --------->YAB1  ----
 
gatagattcctgtagcaacaaagaatcattcacttgcttgagctagagacgaagttcaatgtgactcagagtgtgaatgcaaataataggattctcagag  8759300
                                                                     ----------->HVH21
                                                           --------->AHL20(2)
                                                           <---------AHL25(3)
                                                           <---------AHL25(1)
                                                         <---------WOX13(2)
                                                         --------->WOX13(2)
        ------->TEIL                          ---------->DOF2 <-----------GT1
       <---------CCA1(2)              ------->TEIL     <---------AHL20(2)                          <
  <---------RVE1(2)            --------->CCA1(2)       --------->AHL20(2)                  <--------
------->DOF5.7(1)             <---------ARR11(3)      --------->AHL20(2)                  <---------WOX13(2)
------>DOF2                   --------->ARR11(3)   <----------DOF2 <----------DOF2        --------->WOX13(2)
 
aaagagatttgtatcttatagagagagttgagagatatatgtatgtgtgaaaagcttttaaattaaaaccctttgacaacaaaacaaattgctaatgaag  8759400
                                                                                                   <
                                                                                                   -
                                                                                              <-----
                                                                                             <------
                                                                                      <---------AHL25(1)
                                                                                      --------->AHL12(1)
                                                                                      <---------AHL25(2)
                                                                                      --------->AHL25(3)
                                                                                      --------->AHL25(1)
                                                                                      <---------AHL12(1)
                                                                                      <---------AHL25(3)
                                                                                      --------->AHL25(2)
                                                                                      <---------AHL20(3)
                                                                    <---------DOF5.7(1)<---------AHL12(2)
                                                                   <---------DOF5.7(1)--------->AHL20(1)
     <---------GATA12                                             <---------DOF5.7(1) <---------AHL20(1)
     --------->ARR11(3)                                  <---------WOX13(2)           --------->AHL20(2)
     <---------ARR11(3)                                --------->AHL20(2)             --------->AHL20(3)
--------->YAB1                                         <---------AHL20(2)             <---------AHL20(2)
--------->YAB5                 <-----------GT1         --------->AHL25(3)            --------->AHL20(2)
---------ATHB12   <---------DOF5.7(1)               <----------DOF2<----------DOF2   --------->AHL25(3)
-ATHB12          ------>ZmHOX2a(1)        <-----------GT1--------->WOX13(2)    <---------ANAC46<----
 
aaatcataaatcttctcttcctcttatatagttttcacctattttttgctgttttcttttaatttcttctctttttctacttctgtgaataaattagtct  8759500
<- Previous    Next ->

AGI:  At2g20290.1   
Description:  XIG (Myosin-like protein XIG); motor/ protein binding. similar to MYA2 (ARABIDOPSIS MYOSIN) [Arabidopsis thaliana] (TAIR:AT5G43900.1); similar to XIH (Myosin-like protein XIH) [Arabidopsis thaliana] (TAIR:AT4G28710.1); similar to XIB (Myosin-like protein XIB) [Arabidopsis thaliana] (TAIR:AT1G04160.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN64632.1); similar to myosin XI-2 [Nicotiana benthamiana] (GB:ABJ53197.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40520.1); contains InterPro domain Myosin S1 fragment, N-terminal; (InterPro:IPR008989); contains InterPro domain Myosin, N-terminal, SH3-like; (InterPro:IPR0
Range:  from: 8750356    to: 8758959    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version