AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         --------->ANAC58
                         --------->ANAC58
                       ---------->DOF2
                    <-----------HVH21
                   --------->bZIP60(1)                                <---------AHL20(1)
                   <---------O2                                       --------->AHL20(1)
                   <---------TGA1a                                  <---------AHL12(2)
                   --------->TGA1a                                 --------->AHL20(2)
                   <---------TGA2(1)                               <---------AHL20(2)
                   <---------bZIP60(1)                             --------->YAB1
                   <---------ANAC46                                <---------AHL25(3)
                   ===============bZIP_DOF                         <---------AHL20(3)     --------->RVE1(2)
                   --------->TGA2(1)                 <---------WRKY18(1)                  <---------ARR14(2)
------->RVE1(2)    --------->O2                     --------->WRKY12--------->AHL12(2)    --------->ARR14(2)
--------GATA12   --------->MYB52(1)           <-----------RAV1(1)<---------AHL20(3)       <---------ARR11(2)
------AHL12(1)   <---------TGA2(2)           <---------YAB1      --------->AHL25(2)       --------->ARR11(2)
----->AHL12(1)  ----------->HVH21         <---------YAB1         --------->AHL20(3)      --------->KAN1
------AHL25(3)  ----------->TGA1         --------->RVE1(2)      --------->YAB1           --------->GLK1(1)
------AHL20(2)----------->RAV1(2)        <---------ARR11(3)  --------->YAB1              <---------GLK1(1)
--->AHL12(2) --------->GATA12            --------->ARR11(3)----------->RAV1(1)   <---------YAB1
----AHL12(2) <---------GATA12      --------->YAB1<---------MYB46(3)--------->AHL20(3)    <---------CCA1(2)
-->YAB1  ------>ZmHOX2a(1)       --------->RVE1(2)  --------->WRKY38(1)--------->CCA1(2) <---------KAN1
 
aaatctaaactcctcagacctgacgtcaaagcaaactatcacaatatcattgttgttgaccccagcataataatatataagaccatcaatgcatatccct  8497800
                                --------->KAN4(2)
                                ----------------------->TaNAC69(2)
                               <---------HSFB2a(1)                                         ---------
                               ------>ZmHOX2a(2)                                      <---------WOX13(1)
                               ==================================HOX2a_HOX2a         --------->WOX13(2)
                               --------->HSFB2a(1)                                  --------->ATHB12
                             --------->GATA12                                       <---------ICU4
                             <---------RVE1(2)                                     <---------YAB1
                     ----------->RAV1(1)                                           --------->ICU4
                     <<<<<<<<<<<<<<<<<LFY                    ----------->GT1     --------->YAB1    <
                  --------->ANAC58              <-----------GT1                  --------->YAB5 <---
    --------->DOF5.7(1)--------->ATHB12         --------->ARR11(2)     <---------YAB1<---------WOX13(2)
  ---------->DOF2 --------->ANAC58      ----------->HVH21 ------>ZmHOX2a(1)     <---------YAB1 <----
 
ccatcgaaagaacgatgtggtatgcaacattggatcgttctccatgacatgtttccacttcctaaggtcaaaatatgatgcatatgataattgacgacta  8497900
                                                          <---------AHL20(2)
                                                          <---------AHL12(1)
                                                          --------->AHL12(1)
                                                         <---------AHL12(2)
                                                        <---------AHL12(2)
                                                        --------->AHL12(2)
                                                       <---------AHL25(3)
                                                      <---------AHL20(2)
                                                      --------->AHL25(1)
                                                      --------->AHL25(3)
                                                      <---------AHL12(3)
                                                      --------->AHL12(3)
                                                      --------->AHL20(2)
                                                      <---------AHL25(1)
                                                     --------->AHL12(2)
                                                     <---------AHL12(2)
                                                    --------->YAB1
                           <---------ARR14(2)     <---------AHL20(3)
                           --------->ARR14(2)     <---------AHL12(3)
                           <---------ARR11(3)     --------->AHL25(1)
                          <------ZmHOX2a(1)       --------->AHL20(2)
                    <---------ICU4           <---------YAB1
                    --------->YAB1        ----------->TGA1--------->KAN1
                   <---------YAB5         ----------->HVH21
                   <---------YAB1       <---------At4g35610          <---------DOF5.7(1)
                 <---------ICU4         <---------TGA1a--------->AHL20(2)
                 --------->YAB1         ========================================bZIP_DOF
                <---------YAB5          --------->At4g35610<---------ICU4
               --------->ARR11(3)  --------->At4g35610--------->AHL12(1)
>YAB5         --------->YAB1       --------->ZAT2 --------->AHL20(3) <----------DOF2               -
------ZmHOX2a(1)<---------YAB1     <---------At4g35610<---------AHL12(1)                         <--
--------RAV1(2)<---------ARR11(3)  <---------ZAT2--------->YAB1     <---------DOF5.7(1)          <--
-----ZAT14   <---------YAB1--------->ARR11(3)----------->GT1        <---------DAG2  <---------KAN1 -
 
caggagacgacttcttatgatcatcatcaggattttgaagctgaggtgacgataaaaataaataatcgctaccttttctgtaggcgaacaatagcttcgg  8498000
                                                                            ------->GAMYB
         ------>ZmHOX2a(2)                                                 --------->ANAC58
        <------ZmHOX2a(2)                                                  --------->ANAC58
        --------->CCA1(2)                                                --------->MYB52(1)
       <---------GATA12                                               <---------ANAC55(2)
       <---------ARR14(2)                                             --------->ANAC58
       <---------AGP1                                                 --------->ANAC46
       --------->ARR14(2)                                             --------->ANAC55(2)
       --------->AGP1                                                 --------->ANAC58
       --------->GATA12                                               --------->ANAC55(1)
       --------->RVE1(2)                                           <---------ARR11(2)
       --------->ARR11(3)                                          --------->ARR11(2)
       <---------ARR11(3)                                          <---------RVE1(2)              --
       <-----------ARR10               <---------DEAR3(1)          --------->ARR14(2)             --
   ---------->DOF2                     <---------RAP2.6(2)    <---------ANAC46                    --
-------->ANAC58                       --------->RAP2.6(3)     <---------ANAC58                    <-
-------ANAC58              --------->At5g28300   --------->ALFIN1  <---------ARR14(2)             --
-------ANAC58             ----------->GT1      --------->ALFIN1  ----------->ARR10               ---
-------->ANAC58     <---------KAN1    <---------ORA47(1)      <---------ANAC58                  <---
 
gcgagccaaagatctagtcaagaacaactcggtgaaatatggacggctaagtgtggaggcccattgcttcgatacgcaacgacatctcgctatagaattc  8498100
                                           <---------AtLEC2
                                        ================================HOX2a_HOX2a
                                        ------>ZmHOX2a(2)
                                       --------->GLK1(1)
                                       --------->At4g35610
              --------->ARR11(3)       <---------At4g35610
              --------->RVE1(2)        <------ZmHOX2a(2)
              <---------ARR14(2)       =================================HOX2a_HOX2a                <
             <---------KAN1           --------->ARR11(2)                                          <-
             --------->RVE1(1)        <---------ARR14(2)                                         <--
           --------->YAB1             <---------ARR11(2)                                         XXX
           <---------GLK1(2)          --------->GATA12                                           ---
     --------->TOE1(3)                <---------GATA12                                          ----
     --------->TOE2(3)                <---------RVE1(2)                                         ----
 --------->MYB46(3)                   <---------ARR11(3)                                        <---
------->DREB2C(2)                     --------->ARR11(3)                                        <---
------->DEAR3(1)                --------->WOX13(2)                                              ----
------->DEAR4(1)             <------ZmHOX2a(2)                                                  <---
--------ETT(1)<---------ARR11(3)<---------WOX13(2)                                          <-------
------->At1g77200           --------->GATA12                            --------->ZAT18     <------NtERF2
------>DEAR3(2)             --------->ARR11(3)                     ---------->DOF2         ---------
------At5g28300       --------->YAB1  --------->ARR14(2)         ------>ZmHOX2a(1)   <---------AtLEC2
 
accgacaacctcaagaatatctcgataatgagatcaattgggatctgcaaggagtttttagttccatcctctaagcgcagagacgttttcatggccgaaa  8498200
---------AHL12(2)
--------AHL12(2)
-------AHL25(3)
XXXXXXXXXXXXXXXXX>MIR1887
------>AHL20(2)                                                    --------->ANAC58
----->AHL20(2)                                                     --------->ANAC58
----->AHL25(3)                                                     <----------ID1     ------------>CBF
------AHL20(2)                         --------->MYB46(3)        ---------->DOF2     <<<<<<<<<<<<<<<
------AHL25(1)             --------->HSFB2a(2)               ----------->GT1      --------->WOX13(1)
----->AHL25(1)             <---------HSFB2a(2)        ---------->DOF2       ---------->DOF2---------
------AHL12(3)            --------->REM1(2)    --------->At5g28300--------->DOF5.7(1)--------->YAB1
--RAP2.6(3)            <---------ANAC46------------>CBF      --------->ANAC58 ----------->GT1
>RAP2.6(2)        --------->KAN1 >>>>>>>>>TBF1----------->GT1--------->ANAC58--------->DAG2---------
 
taaataaaccctaagagagagagactccttgtagaagaagaaaccaatgcggtaaaacaaaggcaagtaaaagccaaaaaaaagttaatcacaatggtaa  8498300
                                                                   ------>MYB46(1)
                                                                   --------->MYB52(1)
                                                                  --------->MYB55(1)
                                                                 <---------MYB59
                                                              <-----------GT1
                                                            <---------MYB52(2)
                                                           ------>MYB83
                                                           ------>MYB46(1)
                                                         ------->GAMYB
                                                        --------->MYB46(3)
                     --------->ARR14(2)                ------>MYB83------>MYB83
                     --------->ARR11(2)                --------->ANAC58      <---------TOE2(3)     -
<<LFY                ---------->DOF2                   --------->ANAC58     ---------->DOF2        <
-->GT1        --------->DOF5.7(1)                      ------>MYB46(1) ----------->GT1            --
>YAB1       ---------->DOF2            <---------ZAT2  -------->P<---------MYB46(2)   --------->ANAC55(2)
 
aaacatggactgagagaaagcccgtatagcccaaagtttccaagcttgtataaggcccaaccaaataacctaacgagtttaaagttcaaacgtgatgaaa  8498400
                                                                                                <---
                                                                                            --------
                                                                                            <-------
                                                                                           <--------
                                                                                          <---------ERF1
                                                                                          <---------RRTF1(1)
                                                                                          ------>NtERF2
                                                                                         <---------RAP2.3(2)
                                                                                         <---------RAP2.6(2)
                                                                                         <---------DEAR3(1)
                                                                                         <---------RAP2.3(3)
                                                                                --------->YAB1 <----
                                                                                --------->YAB5<-----
                                                                               <---------YAB1-------
                                                                       ------>NtERF2     <---------RRTF1(2)
          <---------ANAC58                                           --------->RAP2.6(3) <---------DREB2C(2)
          <---------ANAC58                                          <---------ATERF1(1)  <---------RRTF1(3)
       <-----------GT1          --------->AHL25(1)                  ------>NtERF2 <---------YAB1----
     <----------DOF2            --------->AHL20(3)                 --------->DEAR3(1)  --------->MYB52(1)
<---------At5g28300             --------->AHL20(2)        --------->TOE1(3)  --------->YAB1---------
<---------DOF5.7(2)             ----------->TBP           --------->TOE2(3)  <---------ICU4<------NtERF2
-------->ARR11(2)               <---------AHL20(2)--------->HSFB2a(2)--------->ATERF1(1)--------->RAP2.6(3)
---------ARR11(2)               --------->AHL12(3)<---------HSFB2a(2)*TSS   --------->ICU4<---------RAP2.3(1)
------->DOF5.7(2) <---------TOE1(2)             <---------ANAC46   ----------->HVH21  ----------->HVH21
 
cgttaccgttttagcgtttctcatgtttcttccatataaatagttttagttttgtagaaaaccctaatcgacgacggccattatgataaatgacggcgga  8498500
                                                            <---------ALFIN1
                                                           <------NtERF2
                                                          <<<<<<<<<AtERF-3
                                                          <---------ORA47(2)
                                                          <---------ERF1
                                                          <<<<<<<<<AtERF-4
                                                          ------>NtERF2
                                                          <---------RAP2.3(1)
                                                         <---------RAP2.3(2)
                                                         <---------bZIP60(1)
                                                         <---------DEAR3(1)
                                                         <---------RAP2.6(2)
                                                         <---------RAP2.3(3)
                                                         --------->bZIP60(1)
                                                         <---------ATERF1(2)
                                                         --------->ATERF1(2)
                                                        --------->RAP2.6(3)
                                                        --------->ATERF1(1)
                                                        <------NtERF2
                                                       <---------ATERF1(1)
      --------->ARR14(2)                               <---------ERF1
      <---------ARR11(2)                              <---------DEAR3(1)
      <---------ARR14(2)                            <---------ANAC58
    --------->LBD16                                 <------MYB83
  <---------LBD16                                   <------MYB46(1)
------At4g35610                                     <---------ANAC58
->ALFIN1                                           --------->MYB111(2)
--DEAR3(1)                  --------->GLK1(1)      <---------AtMYB61
-LBD16--------->ARR11(2)    <---------GLK1(1)      --------->MYB111(1)
-------ARR10            <---------HSFB2a(2)        --------->MYB55(2)                --------->KAN1
-NtERF2       <---------ANAC46                     <---------MYB46(3)             --------->ANAC58
-->LBD16     <---------At4g35610                   --------->MYB46(2)  <---------ANAC58   ------>ZmHOX2a(1)
----->At4g35610     <-------GAMYB             <------ZmHOX2a(1)        <---------ANAC58  --------->TOE2(3)
>ATERF1(1)   --------->At4g35610          <------ZmHOX2a(1)--------->ATERF1(1)    --------->ANAC58
 
gctaaaccggagacgctgcttagggttgcagaaatcggtggaagaggaaggagtttggtggcggcacagtctcttcgtgctggacaagttatcctcagag  8498600
                                                                               --------->At4g35610
                                                                               <---------At4g35610
                                                                            <---------MYB52(1)
                                                                          <---------MYB46(3)
                     <------------------------ANAC81                      --------->MYB52(2)
                     <---------DOF5.7(1)                                <---------MYB52(1)
                     <---------DAG2                                   <---------ANAC58       -------
              --------->ZAT14                      ------>ZmHOX2a(1)  <---------ANAC58    ------>NtERF2
              <---------ZAT14                  <-----------GT1     <---------ARR11(2) <---------DEAR3(1)
        ------>ZmHOX2a(1)               ------>ZmHOX2a(1)          --------->ARR11(2)<---------At4g35610
   ------>ZmHOX2a(1) <----------DOF2 ------>ZmHOX2a(1)             <-----------GT1<-------TEIL
 
agtctcctctccttctctactctgcttttccatttctctcctcctctgtttctccttactgcgaccattgtttccgtttgttagcttcatcggcgcatca  8498700
<- Previous    Next ->

AGI:  At2g19630.1   
Description:  F-box family protein. Identical to Putative F-box protein At2g19630 [Arabidopsis Thaliana] (GB:Q9ZUN0); similar to F-box family protein [Arabidopsis thaliana] (TAIR:AT1G31080.1); contains InterPro domain F-box associated type 3 (InterPro:IPR013187); contains InterPro domain Cyclin-like F-box (InterPro:IPR001810); contains InterPro domain F-box associated type 1 (InterPro:IPR006527)
Range:  from: 8497299    to: 8498192    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g19640.1   
Description:  ASHR2 (ASH1-RELATED PROTEIN 2). Identical to Histone-lysine N-methyltransferase ASHR2 (ASHR2) [Arabidopsis Thaliana] (GB:Q9ZUM9;GB:Q84WB9;GB:Q94CD2); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G06620.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN82112.1); contains InterPro domain SET; (InterPro:IPR001214)
Range:  from: 8498470    to: 8500002    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version