AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                           <----------DOF2
                                    <-------GAMYB
                                   <---------MYB46(3)              <----------DOF2
<----------DOF2                    <------MYB46(1)        <------MYB83
---------DOF5.7(1)                 <------MYB83   <---------MYB46(3)               <-----------GT1
------ANAC58          <---------ANAC46  <---------YAB1    ----------->GT1       ------->TEIL
------ANAC58          <---------ANAC58 --------->KAN4(2)  <------MYB46(1) <-------TEIL        <-----
--ANAC58              <---------ANAC58--------->KAN1 --------->KAN1--------->TOE1(3)  --------->TOE1(3)
--ANAC58     <---------ICU4       <---------AtMYB61<-------GAMYB   --------->TOE2(3)  --------->TOE2(3)
--GT1       --------->ICU4     <-----------RAV1(1)--------->MYB52(2) --------->AHL20(2)       <-----
 
cttcttttctatgtcataactacaggcttgtattgtgttggttattcttttgtttgttgttcggtttaaactttaaatacatgtatttaccttcaaactt  8156200
                                                                <---------AHL25(1)
                                                                <---------AHL12(1)
                                                                --------->AHL12(1)
                                                                <---------AHL25(3)
                                         --------->DOF5.7(1)    <---------AHL12(3)
                                     --------->LBD16           --------->AHL20(1)
                                     ----------->GT1           <---------AHL20(1)
                         <---------AHL12(1)                    --------->AHL25(3)
                         --------->AHL12(1)                    --------->AHL20(3)
                         <---------AHL20(2)                    <---------AHL25(2)
                         --------->AHL20(2)                    --------->AHL25(2)
                         <---------AHL12(3)                    --------->AHL12(1)
                         --------->AHL12(3)                    <---------AHL12(1)
                         --------->AHL25(1)         <-----------GT1
                         <---------AHL25(1)      <---------AHL12(3)
                         <---------AHL25(3)      <---------AHL25(3)
                         --------->AHL25(3)      --------->AHL25(1)
                         <---------AHL25(2)      --------->AHL12(3)
                        --------->AHL20(2)       <---------AHL25(1)
            --------->GLK1(2)       <---------HSFB2a(2)        <---------ARR11(3)                 <-
           --------->GATA12<---------WOX13(2)    <---------AHL20(2)                               <-
           <---------GLK1(2)        --------->HSFB2a(2)   --------->LBD16                         <-
           <---------RVE1(2) <---------AHL20(2) <---------AHL12(1)                   --------->MYB52(2)
----DAG2  --------->KAN1--------->AHL25(3)      --------->AHL20(2)         <---------ANAC58      <--
-----DOF2----------->ARR10 --------->WOX13(2)   --------->AHL25(3)         <---------ANAC58 <-------
 
tttttttttggtgagattctcaaactatttaatttaagtccagaaaaacgatttatttctccccaaaatatttgtatttcttactggtttgtttgaaacc  8156300
                                                                               <---------ANAC58
                                                                               <---------ANAC58
                                                                      --------->ARR14(2)
                                                                      <---------ARR14(2)
                                                                    --------->LBD16
                                                   --------->YAB5  <---------ANAC58
      ------>NtERF2                           ----------->RAV1(1)  <---------ANAC55(1) --------->YAB1
---------DOF2                              --------->ANAC46        <---------ANAC58  --------->ANAC58
--------DOF5.7(1)                   <---------HSFB2a(2) <---------TOE1(3)   <---------GLK1(2) ------
--------DAG2           --------->ANAC46    --------->ANAC58        <---------ANAC46  --------->ANAC58
-------DOF5.7(1)     <---------AtLEC2      --------->ANAC58       <---------LBD16 <---------ZAT18
----GT1          <----------DOF2    --------->HSFB2a(2) <---------TOE2(3) <---------YAB1   ---------
 
cctttttgaggcctcttggactttacatggcacaaacttggagaagaagcaacacgattagggttttgttccgggtcttgattcttgcactcatcaatct  8156400
                                                   <-----------GT1
                                                 <---------WOX13(2)
                                                <---------AHL25(3)
                                                <---------AHL12(2)
                                               --------->AHL12(1)
                                               <---------AHL12(1)
                                               <---------AHL20(1)
                                               --------->AHL25(2)
                                               --------->AHL25(1)
                                               <---------AHL25(1)
                                               <---------AHL25(3)
                                               <---------AHL25(2)
                                               --------->AHL25(3)
                                               <---------AHL20(3)
                                               --------->AHL20(3)
                                               --------->AHL20(2)
                                               --------->AHL20(1)
                                               <---------AHL20(2)
                                               --------->AHL12(3)
                       <---------YAB5          <---------AHL12(3)
                       <---------YAB1         --------->AHL25(3)
                    <---------YAB5            --------->AHL12(2)
                    <---------ATHB12         <---------WOX13(2)
      --------->At4g35610                  <---------YAB1                             --------->ZAT6
   <---------MYB52(1)--------->YAB1      ----------->GT1                           --------->ANAC46
<---------ATHB12  <---------GLK1(1)    <---------RVE1(2)                          ------>ZmHOX2a(1)
<---------YAB5    --------->GLK1(1)------>ZmHOX2a(1)                           <---------YAB1
--->YAB1    --------->ZAT2    <---------At4g35610--------->WOX13(2)         <---------YAB1       ---
>WOX13(1)   <---------ZAT2<---------MYB52(1) --------->WOX13(2)         <---------DOF5.7(1) --------
 
tcaatcgtttgctcaagctggaaatcatcgttgtgctccttagattgtaattaattactcttctcgttctatctctcttattatcctcgacactagcatg  8156500
                                                                       --------->RVE1(2)
                                                                       <-----------ARR10
                                                                       --------->ARR11(3)
                                                                       <---------ARR11(3)
                                                                  ------------>CBF
                                                                  <-------TEIL
                                                               --------->ANAC46
                                                               --------->ANAC58
                                                               --------->ANAC58
         --------->YAB5                                       --------------->AtSPL3
         --------->HSFC1(2)                             --------->ANAC58
     <---------MYB46(3)                                 --------->ANAC46
  --------------------->WRI1                --------->YAB5   --------->REM1(1)         ---------->ID1
  <---------ANAC46      ------>ZmHOX2a(1)  <---------YAB5   <---------REM1(2)          ---------->ARF1
------>At4g35610 ------>ZmHOX2a(1)         --------->MYB46(3)<---------ALFIN1 ------->GAMYB
->YAB1   <---------HSFC1(2)      ---------->DOF2        --------->ANAC58   --------->MYB52(1)-------
 
agcttcagtggatgtttctcctatttcctcatatgcaaaagctctaaccattctctccctcgctacacgtacaatatctaacgctctcttgtctccctgc  8156600
                                                          <---------AHL20(3)
                                                          <---------AHL20(2)
                                                          <---------AHL25(1)
                                                          --------->AHL20(3)
                                                        --------->AHL12(2)
                                                        --------->AHL12(3)
                                                        <---------AHL12(3)
                                                        <---------AHL20(2)
                                                        <---------AHL25(2)
                                                       --------->AHL12(2)
                                                       <---------AHL12(2)
                                                      <---------AHL12(2)
                                                      --------->AHL12(2)
                                                      <---------AHL20(2)
                                                      <---------AHL12(1)
                                                      --------->AHL12(1)
                                                      <---------AHL12(3)
                                                      --------->AHL12(3)
                                                     --------->AHL12(1)
                                                     <---------AHL12(1)
                                                     <---------ARR11(3)
                                                     --------->AHL20(3)
                                                     --------->ARR11(3)
                                                     <---------AHL20(3)
                                                     <---------AHL25(1)
                                                     --------->AHL25(1)
                                                     --------->AHL25(3)
                                                     <---------AHL25(2)
                                                     <---------AHL20(2)
                                                     --------->AHL25(2)
                                                     --------->AHL20(1)             <---------AHL20(2)
                                                     <---------AHL25(3)             <---------AHL20(3)
                                                     <---------AHL20(1)            --------->AHL12(2)
                                                    --------->AHL12(1)            --------->AHL12(1)
                                                    --------->AHL12(3)            <---------AHL12(1)
                                                    <---------AHL12(1)            --------->AHL12(3)
                                                    <---------AHL12(3)            <---------AHL12(3)
                                                    <---------AHL25(1)           <---------ARR11(3)
                                                    --------->AHL20(2)           <---------AHL20(1)
                    --------->SPL7(1)             <---------AHL12(2)             --------->AHL20(1)
             <---------DOF5.7(1)                 <---------AHL25(3)              --------->AHL25(3)
            <---------DOF5.7(1)                  <---------AHL20(2)      --------->GLK1(2)      <---
            <---------DAG2   ----------->GT1    --------->AHL25(3)    <---------RVE1(2)         ----
            <----------DOF2 <---------TOE2(3) --------->WOX13(2)     --------->YAB1<---------AHL12(2)
      <---------GLK1(1)   ---------->DOF2     <---------WOX13(2)    <---------ZAT6<---------AHL20(2)
 <------------CBF <---------SPL7(1)   <-----------GT1--------->AHL20(2)--------->KAN1           <---
-->AtLEC2  <---------DOF5.7(1)   <-----------TBP--------->AHL20(2)  <---------YAB5<---------AHL25(1)
 
aaaccattgaattccctttttcgaacggacaaaggtatatataactctctattaaatatatttttttgttagtgataatctctatatatttttgtattag  8156700
                                                                                              ------
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                --------->AHL12(2)                          --------
                                             --------->AHL25(3)                            ---------
                                             <---------AHL20(1)                          <---------AHL20(3)
                                             <---------AHL25(3)                     <---------AHL12(2)
                                             <---------AHL20(2)                     <---------AHL12(3)
                                             --------->AHL25(1)                     --------->AHL12(3)
                                             <---------AHL25(1)                     --------->AHL20(3)
                                             --------->AHL20(2)                     --------->AHL12(2)
                                             <---------AHL25(2)                     --------->AHL25(3)
                                             <---------AHL20(3)                     <---------AHL25(2)
                                             --------->AHL25(2)                     --------->AHL25(2)
                                             --------->AHL20(3)                    --------->AHL12(3)
                                             --------->AHL12(3)                    <---------AHL25(1)
                                           <---------AHL12(2)                      <---------AHL25(3)
                                          --------->AHL20(1)                       --------->YAB1
                                          --------->AHL25(2)                       <---------AHL20(3)
                                          --------->ARR11(3)                       --------->AHL20(3)
                                          --------->AHL12(1)                       <---------AHL25(2)
                                          <---------AHL12(1)       <---------AHL25(3)    --------->AHL25(1)
                                          <---------ARR11(3)       <---------AHL12(1)    <---------AHL25(3)
                                          <---------AHL25(2)       --------->AHL12(1)    --------->AHL25(3)
                                          <---------AHL20(1)       <---------AHL25(2)    <---------AHL12(3)
                                          --------->AHL20(3)       <---------AHL25(1)    <---------AHL25(1)
                         <----------DOF2  <---------AHL20(3)       --------->AHL20(2)    --------->AHL20(2)
                 <---------ANAC58        <---------KAN1            <---------AHL20(2)  <---------AHL12(2)
                 <---------ANAC58        --------->AHL12(1)        <---------AHL20(3)<---------AHL12(1)
               <---------AHL20(2)  --------->ALFIN1    --------->AHL12(2)          --------->AHL20(2)
       --------->YAB5   <---------DOF5.7(1)--------->AHL12(2)      --------->AHL25(2)--------->ICU4
      <---------YAB5 <---------ANAC58    <---------AHL12(1)       --------->AHL12(2)<---------AHL20(3)
  <---------RVE1(2)  <---------ANAC58   <---------KAN4(2)         --------->ICU4   <---------AHL12(3)
------RVE1(2)  <-----------GT1   <---------ANAC46    --------->AHL20(2)         --------->YAB1<-----
----->GATA12 <---------WOX13(2)  <---------ANAC58    <---------AHL20(2)  <---------ANAC58--------->AHL12(3)
------GATA12 --------->WOX13(2)  <---------ANAC58    --------->AHL25(3)  <---------ANAC58<---------AHL20(2)
 
atttagataatcactaaattacttgcttcttttttagcgtgggaatattttattttttaatttttagtaattttttgtgtgactaataatatttaaattt  8156800
                                               --------->AHL25(1)
                                               --------->AHL12(3)
                                               <---------AHL25(1)
                                               --------->AHL25(3)
                                               <---------AHL25(3)
                                               <---------AHL12(3)
                                            <---------AHL12(2)
                                           <--------ATHB1
                                           <---------ICU4
                                           --------->ATHB51
                                           --------->AHL25(1)
                                           <---------AHL12(1)
                                           --------->AHL20(3)
                                           <---------AHL20(2)
                                           <---------AHL20(3)
                                           <---------AHL25(1)
                                           <---------AHL25(3)
                                           <---------AHL25(2)
                                           --------->AHL25(2)
                                           --------->AHL20(2)
                                          --------->ICU4
                                        --------->YAB1
                                       --------->AHL20(2)
                                       <---------AHL20(2)
                                       <---------AHL25(3)
                                      --------->AHL25(3)
                                      --------->AHL20(3)
                                      <---------AHL20(3)
                                      <---------AHL25(1)
                                      --------->AHL25(2)
                                      <---------AHL25(2)
                                      --------->AHL25(1)
                                      <---------AHL20(2)
                                      --------->AHL20(1)
                                      <---------AHL20(1)                                          --
                                      --------->AHL20(2)                                    --------
                                     <---------AHL12(2)                                     <-------
                                     --------->AHL12(2)                                     <-------
                                    <---------AHL12(2)                                      --------
                                   --------->ATHB51                                         --------
                                   <--------ATHB1                                           <-------
                                   <---------ICU4                                 <---------AHL12(1)
                                   --------->AHL20(2)                             <---------AHL20(1)
    --------->AHL25(2)             <---------AHL25(2)                             --------->AHL20(1)
    <---------AHL25(3)             --------->AHL25(1)                             --------->AHL12(1)
    <---------AHL25(2)             --------->AHL25(2)                             --------->AHL20(2)
   <---------AHL12(3)              <---------AHL20(3)                             <---------AHL20(2)
--->AHL20(1)                       --------->AHL20(3)                             --------->AHL25(3)
--->AHL12(1)                       <---------AHL20(2)                             <---------AHL25(3)
----AHL12(1)                       <---------AHL12(1)                             <---------AHL25(2)
--->AHL20(2)                       <---------AHL25(1)                             --------->AHL25(2)
----AHL25(2)                       --------->AHL12(1)                             <---------AHL20(3)
----AHL20(2)                       <---------AHL25(3)                             --------->AHL25(1)
----AHL25(3)                      --------->ICU4           --------->WOX13(2)     <---------AHL25(1)
--->AHL25(2)                      --------->AHL12(1)     <---------AHL20(2)      --------->AHL20(2)
-->AHL12(1)                       --------->AHL25(3)     --------->AHL20(2)      --------->AHL25(1)
---AHL12(1)                      --------->AHL12(2)    --------->TOE2(3)         --------->AHL12(3)
-->AHL25(3)                      <---------AHL12(2)    <----------DOF2           <---------AHL20(2)
---AHL25(2)                     --------->YAB1 <---------AHL20(2)                --------->AHL25(3)
-->AHL12(3)                  --------->TOE2(3) --------->AHL20(2)      <---------YAB1       <-------
---AHL12(3)                 <---------ZAT6--------->AHL12(1)          <---------At5g28300  ---------
->AHL12(2)                  ----------->GT1--------->AHL12(1)        <-----------GT1     --------->WOX13(2)
>AHL12(2)  <-----------TBP <---------YAB1--------->AHL12(2)<---------WOX13(2)    <---------AHL25(1)
----AHL25(1)              <------------CBF--------->AHL25(3)       --------->WOX13(2)    <---------WOX13(2)
 
tttgaaatatatgtttttatatgtctacttattgttaataatttaataatttaaatttctttaattttaaaattaccatggcaaataaattcaatttata  8156900
                                                                              <------ZmHOX2a(1)
                                                                            <---------TOE2(3)
                                                                      --------------->AGL15
                                                                      <---------------AGL15
                                                                      <----------DOF2
                                                                     ===============================
 --------->MYB52(1)                                                  <-----------------AGL3
------->ANAC46                                                       ----------------->AGL3     ----
->AHL20(2)                                                           <-----------------AG       <---
--AHL20(2)                                                           <-----------------AGL1    -----
--AHL12(3)                                                           <-----------------AGL2 --------
->AHL25(1)                                                      --------->AHL20(3)         ---------
->AHL12(3)                                                   <---------ARR11(3)--------->ARR11(2) --
--AHL25(3)                             <-----------GT1    ----------->RAV1(1)----------->GT1--------
--AHL25(1)                       <---------TOE2(3)  --------->YAB1 <-----------GT1         ---------
>AHL25(3)                   <----------DOF2     <---------AHL20(2)<<<<<<<<<<GT-3b     <-------------
 
tacacaactgtttttaaaaactctaatacaacttttaagtttttacaacattttatcaaaacaacatatttttctttataaggaaacacccataaaaagt  8157000
                                                                                       --------->WOX13(2)
                                                                                       <---------WOX13(2)
                                                                                     --------->AHL25(2)
                                                                                     <---------AHL25(2)
                                                                                     <---------AHL25(3)
                                                                                     --------->AHL25(1)
                                                                                     <---------AHL20(3)
                                                                                     --------->AHL20(1)
                                                                                     --------->AHL20(2)
                                                                                     <---------AHL20(2)
                                                                                     --------->AHL20(3)
                                                                                     <---------AHL12(3)
                                                                                     <---------AHL25(1)
                                                                                    <---------AHL25(1)
                                                                                    --------->AHL25(1)
                                                                                    <---------AHL12(3)
                                                                                    --------->AHL12(3)
                                                                                    --------->AHL12(1)
                                                                                    <---------AHL20(2)
                                                                                    --------->AHL20(2)
                                                                        --------->AHL20(3)
                                                                        <---------AHL12(3)
                                                                        <---------AHL20(3)
                                                                        --------->AHL25(1)
                                                                       --------->AHL12(3)
                                                       <---------AHL12(2)           <---------AHL25(3)
                                                       --------->AHL25(2)           --------->AHL25(2)
                                                       --------->AHL20(3)           <---------AHL12(1)
                                                       <---------AHL25(2)           --------->AHL25(3)
                                                      --------->YAB1   <---------AHL12(3)<---------AHL12(1)
                                                      <---------AHL25(2)--------->AHL25(2)
                                            <---------YAB1             <---------AHL20(2)--------->AHL12(1)
                                         --------->ICU4<---------AHL20(3)   <-----------GT1
                                        <---------AHL12(2)             <---------AHL20(1)<---------AHL25(3)
  <---------ARR14(2)                    <---------AHL12(3)             --------->AHL20(1)--------->AHL25(3)
  <---------ARR11(2)                   <---------AHL25(3)              --------->AHL20(2)<---------AHL20(2)
  ------>MYB46(1)                     --------->AHL12(3)               --------->AHL25(3)--------->AHL20(2)
  ------>MYB83                        <---------AHL20(2)               --------->AHL25(1)--------->AHL12(3)
  --------->ARR11(2)         ----------->RAV1(1)      --------->AHL25(2)<---------AHL25(3)         -
<---------MYB59     --------->YAB1    --------->AHL25(1)               <---------AHL25(3)<---------AHL12(3)
==MADS_MADS      --------->YAB1       --------->AHL25(3)               <---------AHL25(2)--------->AHL25(2)
----->ZAT18     <---------AHL12(1)    <---------AHL25(1)               --------->AHL25(2)<---------AHL25(1)
------ZAT18    --------->AHL20(2)     --------->AHL12(1)               <---------AHL25(1)--------->AHL25(1)
---->ALFIN1    --------->AHL20(3)     <---------AHL12(1)       <---------GATA12     <---------AHL25(2)
->DOF5.7(1)    --------->AHL25(2)     --------->AHL20(2)       --------->RVE1(2)  --------->WOX13(2)
>DOF5.7(1)     <---------AHL25(2)     <---------AHL12(3)       --------->GATA12   <---------WOX13(2)
----->TEIL     <---------AHL20(3)    --------->AHL12(2)--------->AHL12(2)<---------AHL12(2)    -----
->DAG2        --------->YAB1 --------->MYB52(1)       --------->AHL25(1)--------->AHL12(3)     -----
->DOF2  <---------ARR11(2)  --------->AtMYB61         --------->AHL20(2)<---------AHL20(2)     -----
--AGL15 --------->ARR11(2) --------->MYB46(3)         --------->AHL12(3)--------->AHL20(2)<---------AHL25(3)
 
ggacctatccagttccaaaataataagaaaaccaccagaaaataaatatgaaaacaataatattcaaatccaaataaaattacaaaattaaattaaatac  8157100
<- Previous    Next ->

AGI:  At2g18810.1   
Description:  DNA binding. similar to DNA binding [Arabidopsis thaliana] (TAIR:AT2G31720.1); contains InterPro domain Transcriptional factor B3; (InterPro:IPR003340); contains InterPro domain Protein of unknown function DUF313 (InterPro:IPR005508)
Range:  from: 8155021    to: 8156551    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version