AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   <
                                                                                                   <
                                                                                                   <
                                                                                                 ---
                                                                                               -----
                                                                                               -----
                                                                                           ---------
                                                                                          <---------LBD16
                                                                                          <---------ANAC46
                                                                                         <---------LBD16
                                                                                     --------->AHL12(3)
                                                                                     <---------AHL12(2)
                                                                                     --------->AHL12(2)
                                                                                     <---------AHL12(3)
                                                                                    <---------AHL25(3)
                                                                                    --------->AHL20(1)
                                                                                    --------->AHL25(2)
                                                                                    <---------AHL20(1)
                                                                                    <---------AHL25(2)
                                                                                    <---------AHL12(2)
                                                                                    <---------AHL12(1)
                                                                                    --------->AHL12(1)
                                                               --------->MYB46(3)   --------->AHL12(2)
                                                              ------>MYB83          --------->ARR11(3)
                                                              -------->P           <---------AHL12(1)
                                                              ------>MYB46(1)      --------->AHL12(1)
                                                             --------->MYB55(1)    --------->AHL12(3)
                                                             --------->MYB52(1)    <---------AHL12(3)
                                                            --------->AtMYB61      --------->AHL25(3)
                                                            --------->MYB46(3)     <---------AHL25(3)
                                                           --------->MYB46(3)      <---------AHL25(1)
                                                      <-------TEIL <------ZmHOX2a(2)<---------ARR11(3)
                                                     --------->ARR14(1)           <---------AHL20(1)
                                                     --------->GLK1(2)            --------->AHL25(2)
                                                     --------->CCA1(2)            <---------AHL12(1)
                                                    --------->ARR14(2)            --------->AHL20(1)
                                                    <---------ARR14(2)            --------->AHL12(1)
                                                    <---------GLK1(2)             --------->AHL20(3)
    --------->ZAT18                                 --------->ARR11(1)            <---------AHL25(2)
    <---------ZAT18                   --------->ARR11(2)   --------->DEAR3(2)     --------->AHL25(3)
  --------->ZAT2                  <---------YAB5    <---------GATA12              <---------ARR11(3)
 --------->ARR11(3)             --------->YAB1      --------->GATA12     <---------DEAR3(1)<--------
-------At4g35610<-----------GT1<---------ATHB12    --------->KAN1 <-----------HVH21--------->AHL25(1)
 
agaagagctcgctcagaattcacaaactttgcaaatcatcgtttatgcaattcaagattcggaccaaccgatcacctcggtgcaaaatatttttcgggaa  7706800
 <---------GLK1(2)
--------->YAB5                                                  <---------WRKY18(1)
---------KAN1                                                  --------->WRKY12
---------YAB1<-----------ARR10                                 --------->WRKY38(1)
---------YAB5--------->ARR11(3)                              --------->REM1(2)                    --
------>YAB1  <---------ARR11(3)                             --------->ALFIN1            <--------P--
---->ANAC58  --------->RVE1(2) --------->ANAC58            ------->MYC3              <---------AtMYB61
---->ANAC58 --------->CCA1(1)  --------->ANAC58            <-------MYC3   --------->ZAT18         --
>HSFB2a(2)  <---------KAN1 --------->KAN1            <-------TEIL         <---------ZAT18       ----
-HSFB2a(2)  --------->RVE1(1)  --------->ANAC46    <---------GATA12       <---------ZAT14      <----
 
gcatgattctgagaaatatctccctatgtgttactcgcaacgtagttgggaacagattcaaacgtgttgacctcgtgtgaactatgttttggtagtttga  7706900
                                                                    --------->AHL12(3)
                                                                    --------->AHL25(1)
                                                                    --------->AHL20(2)
                                                                    <---------AHL20(2)
                                                                    <---------AHL12(3)
                                                                    --------->AHL25(2)
                                                                    <---------AHL25(1)
                                                                    <---------AHL25(3)
                                                                    <---------AHL25(2)
                                                                   --------->AHL20(2)
                                                                   --------->YAB1
                                                                 <---------WOX13(2)
           --------->AHL20(1)                                    --------->WOX13(2)   <---------ANAC58
           <---------AHL20(1)                                --------->RVE1(2)   <----------DOF2
         <---------RVE1(2)                            --------->RVE1(2)          <---------DOF5.7(1)
----------------->AGL1                  --------->DAG2--------->ARR11(3)   --------->ZAT6
------->ANAC58                  --------->ICU4        --------->GATA12     <-----------GT1       <--
------->AtLEC2       <----------DOF2   ---------->DOF2--------->GLK1(2)--------->AHL12(1)    <------
------->ANAC58    <-----------GT1  <---------YAB1     <---------GATA12 <---------AHL12(1)    <------
----->KAN1 --------->ARR11(3)<---------YAB5 <---------MYB46(3)------------>CBF   <---------DAG2 ----
-----RVE1(2)   ----------->GT1 <------------CBF ----------->GT1 --------->WOX13(1)    <---------ANAC58
 
catgccaaatgtgatatattgttactttcttagtcattgttataaagttgttagtaaaatctagtatcaattaaaatttcactacttttccttgtttatt  7707000
                                                                              ------->GAMYB
                                                                             <---------MYB55(2)
                                                                             <---------MYB52(2)
                                                                             <---------MYB111(1)
                                                                             <---------MYB111(2)
                                                                             --------->MYB46(3)
                                                                            <---------WOX13(2)
                                                                            <---------At4g35610
                                                                            --------->At4g35610
                                                                            --------->WOX13(2)
                                                                          <---------WRKY38(1)
                                                                          <---------WRKY45
                                                                          <---------WRKY12
                                                                         <<<<<<<<<<WRKY43
                                                                         <<<<<<<<<<WRKY38
                                                                         <<<<<<<<<<WRKY26
                                                                         <<<<<<<<<<WRKY11
                                                                         <<<<<<<<<<WRKY6
                                                                         --------->WRKY18(1)
                                                                 <---------AHL25(2)
                                                                 --------->AHL25(1)
                         <---------------AtSPL8                  --------->AHL12(2)
     --------------->AGL15                                       <---------AHL12(3)
     <---------------AGL15                                       <---------AHL20(2)
    <-----------------AGL3                                      --------->AHL12(1)
    <-----------------AGL2                                      <---------AHL12(1)      <---------WOX13(2)
    ----------------->AGL3                                      --------->AHL25(3)      <-----------
  --------->YAB5      --------->GATA12                         <---------RVE1(1)        --------->WOX13(2)
-------RVE1(2)        --------->RVE1(2)                        <---------CCA1(1)    --------->TOE2(3)
------CBF             <---------GATA12                        --------->ARR11(3) <---------ALFIN1
---WOX13(2)   <---------MYB52(1)  <---------KAN1              <---------ARR11(3)--------->MYB46(3)
----->YAB1   --------->WOX13(2) --------->YAB1                <---------GLK1(2)-------->P         --
 
gatagtgactatttttagttagtcaaatctagtactaataacacctatacaaacaaacttttcaagattttttttggtcaactaccacctaaattggact  7707100
                                        --------->RVE1(2)
                                       --------->GLK1(1)                           ------------>CBF
                                       --------->CCA1(2)                     --------->ANAC58    ---
                                      <---------ARR11(3)                   ---------->DOF2      ----
                                      --------->ARR11(3)              --------->DEAR3(1)        <---
                              <------------CBF                        --------->AtMYB61      <------
                            <---------YAB1                            <---------ALFIN1       -------
-CBF       <---------------AtSPL8 ---------->DOF2                    --------->MYB46(3) ----------->GT1
-------->DOF2             <-----------GT1 --------->YAB1   <---------AHL12(2)--------->ANAC58-------
 
ataaagaacgatatagagtaccttcagtttcaccattgaaagatatcaaaataacaaaaaaaaaaaaacttcaccaccgaaagcaaaacaatagaaaaat  7707200
                                 <---------TOE1(3)
                             <----------DOF2
                         --------->KAN4(2)
                         --------->ARR14(2)                      <---------ARR11(3)            <----
--------->CBF            <---------ARR14(2)                    <---------MYB52(1)        ------>MYB46(1)
----->YAB1              <----------TaMYB80                     --------->DOF5.7(2)       ------>MYB83
--------GT1             --------->KAN1                <----------DOF2             --------->TOE2(3)
---AHL12(2)             <---------KAN1<-----------------AGL3  ----------------------->TaNAC69(2)
-->YAB1             ----------->RAV1(1)  <---------MYB52(1) ---------->ID1        <---------MYB59
-->AHL12(2)       --------->At4g35610 <-----------------AGL2<---------YAB5        <---------DAG2 <--
 
aacaatactttgaaaatgaagagcagcatattctttaagcttctgttattggtttctcttttagtcgttatcttcagtaagtataccttaccaacaatat  7707300
                                                                                    <-----------GT1
                                                                                --------->AHL12(1)
                                                                                <---------AHL12(1)
                                                                                --------->AHL25(2)
                                                                                <---------AHL25(3)
                                                                               <---------AHL12(1)
                                                                               <---------AHL12(3)
                                                                               --------->AHL12(3)
                                                                               <---------AHL12(2)
                                                                               <---------AHL25(1)
                                                                               --------->AHL25(1)
                                                                               <---------AHL25(3)
                                                                              --------->AHL25(3)
                                                                              <---------AHL25(2)
                                                                              --------->AHL25(2)
                                                                              --------->ARR11(3)
                                                                              --------->AHL12(1)
                                                                              <---------AHL12(1)
                                                                              <---------AHL12(2)
                           --------->ARR11(3)                                 --------->AHL12(2)
                           --------->RVE1(2)                                  <---------ARR11(3)
                           <---------ARR11(3)                                 --------->AHL20(1)
                          <---------CCA1(2)                                   <---------AHL20(1)
                        --------->ANAC55(2)                                  <---------AHL12(2)
                      <-----------GT1                                        <---------AHL25(2)
                   --------->AHL12(2)                                        --------->AHL25(2)
                   <---------AHL12(2)                                        --------->AHL12(3)
                  --------->AHL12(1)                                         --------->AHL12(2)
                  --------->AHL20(3)                                         <---------AHL12(3)
                  <---------AHL20(3)                                       --------->AHL20(2)
                  <---------AHL12(1)                                       --------->AHL12(3)
                 --------->AHL25(3)                                        <---------AHL20(3)
                <---------AHL25(2)                                         --------->AHL25(2)
                --------->AHL12(3)              <---------MYB46(3)         --------->AHL25(1)
                <---------AHL12(3)              ----------->GT1            --------->AHL20(3)
                --------->AHL25(2)     <----------DOF2                     <---------AHL12(3)
                <---------AHL12(2)    <---------DOF5.7(1)              --------->YAB1
                --------->AHL12(2)<-----------GT1                      --------->AHL20(2)
               --------->YAB1   <----------DOF2<---------ATHB12      --------->WOX13(2)
-----YAB1      --------->AHL20(2)--------->ZAT14--------->YAB5       <---------WOX13(2)     --------
-------RVE1(2)<---------ATHB12 <---------DOF5.7(1)              ----------->GT1--------->AHL12(1)
 
gattttcaaataaaccaataaaaatttacatatctctttactctttaccaatggttaaaactaaaatttgttaataaaaaaaatatttcacaaaataact  7707400
                                                        <-------TEIL
                                                    <---------TOE2(3)
                                                   ---------->DOF2
                                                  <---------AHL20(2)
                                                <---------WOX13(2)
                                                <---------AHL12(2)
                                              <---------ICU4
                                              <---------AHL12(1)
                                              --------->AHL20(2)
                                              <---------AHL12(3)
                                              <---------AHL25(1)
                                              --------->AHL25(1)                       --------->AHL12(1)
                                              <---------AHL25(3)                       <---------AHL12(1)
                                              --------->ATHB51                        <---------AHL12(2)
                                              --------->AHL12(3)                     --------->AHL12(3)
                                              --------->AHL12(1)                     <---------AHL25(2)
                                             <---------YAB5                          --------->AHL25(2)
                                             --------->ICU4                          <---------AHL20(3)
                                             --------->AHL25(3)                    <---------AHL25(1)
                                            --------->WOX13(2)                     <---------AHL12(3)
                                            --------->AHL12(2)                     --------->AHL12(3)
                                            <---------WOX13(2)                     <---------AHL20(2)
                                          --------->AHL25(2)                       --------->AHL25(3)
                                          --------->AHL12(1)                       <---------AHL25(3)
                                          <---------AHL12(3)                       <---------AHL12(1)
                                          --------->AHL12(3)                       --------->AHL12(1)
                                          <---------AHL20(2)                       <---------YAB1
                                          --------->AHL25(1)                       --------->AHL20(2)
                                          <---------AHL25(1)                      --------->AHL25(2)
                                          <---------AHL12(1)                      <---------AHL25(1)
                                          <---------AHL25(3)                      --------->AHL25(3)
                                          --------->AHL25(3)                      <---------AHL25(2)
                                          --------->AHL20(2)                      --------->AHL20(1)
                                         <---------AHL20(1)                       --------->AHL20(2)
                                         <---------AHL25(1)                       <---------AHL20(3)
                                         --------->AHL25(1)                       --------->AHL20(3)
                                         --------->AHL20(3)                       <---------AHL20(2)
                                         --------->AHL20(2)                       <---------AHL20(1)
                                         <---------AHL20(2)                      --------->YAB1
                                         --------->AHL25(3)                  <---------AHL20(2)  <--
                                         --------->AHL25(2)                  --------->AHL20(2)  <--
                 ---------->DOF2         <---------AHL25(2)            ---------->ID1--------->AHL20(3)
                <---------AHL25(3)     <---------WOX13(2)             <-----------GT1--------->AHL12(2)
        ---------->DOF2                --------->WOX13(2)  <---------YAB5<----------DOF2    <-------
->MYB52(1)----------->GT1  <-----------RAV1(1)<---------AHL20(2)  <---------RVE1(2)--------->AHL25(1)
 
gagtttgcagaaaaagaaataaaagtgtttttgttggacatcaatttaattatttaaagttcgtcatttgatttttcttttttaatataatttttctttt  7707500
               <------ZmHOX2a(2)
    --------->AHL25(3)
    <---------AHL25(1)
    --------->AHL25(2)
    --------->AHL20(2)
    <---------AHL25(2)                <---------ANAC46                     <---------YAB1
    --------->AHL25(1)            <---------ANAC58                       --------->YAB1
    <---------AHL20(2)            <---------ANAC58                   <---------ATHB51
    --------->AHL20(3)            <-------GAMYB                      <---------YAB1
    <---------AHL20(3)       <---------DAG2    <------ZmHOX2a(1)   --------->YAB5    --------->At4g35610
 <---------RVE1(2)        <-----------GT1  ---------->DOF2     <---------DEAR3(1)   --------->GLK1(2)
-------ANAC58 <---------ARR11(3) <---------MYB46(3)    --------->CCA1(2)<---------YAB1
-------ANAC58 --------->ARR11(3)<---------AtMYB61 ---------->DOF2<------NtERF2    --------->KAN1
---DOF2  <---------AHL20(2)  <----------DOF2  <----------ID1  --------->ATERF1(1)<---------RVE1(2)
 
gggtgattttattttaagatcattttgttttacttttggttgtgtttaaaggacaaagctatgcagtcgccgattattgtaatagagatgctgactgtaa  7707600
                                    <---------ALFIN1
                                   ----------->HVH21
                                   <---------MYB52(1)
                                 --------->ANAC55(1)
              <---------SPL7(1)  --------->ANAC46
          ------------------>SPL14<-----------HVH21            <-----------HVH21
    --------->YAB5           <-----------GT1                  --------->TGA2(1)
   <---------YAB1--------->ANAC58--------->ANAC58             <---------bZIP60(1)
 --------->KAN1  --------->ANAC58--------->ANAC58<-----------HVH21
 <---------KAN1 --------->SPL7(1)--------->bZIP60(2)          --------->bZIP60(1)                  -
<---------ARR14(2)   --------->ANAC58   --------------------->WRI1  --------->ARR14(2)      --------
<---------ARR11(2)   --------->ANAC46   <----------DOF2       <---------TGA2(1)            <--------
--------->ARR11(2)   --------->ANAC58  <---------DOF5.7(1) <---------ATHB12                ---------
--------->ARR14(2) >>>>>>>>>>AtWER<-----------TGA1   --------->AtLEC2                      <--------
 
gcgggtatgcttaagaccgtacgcatgcaacttaacccgtcacctttgtatgtgtcatccaaatgatgtcagttcttctaaacaacattgtattccagaa  7707700
<- Previous    Next ->

AGI:  At2g17723.1   
Description:  Encodes a defensin-like (DEFL) family protein.
Range:  from: 7707216    to: 7707757    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version