AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                  ------>ZmHOX2a(2)
                                                 <------ZmHOX2a(2)
                                                --------->ARR11(3)
                                                --------->ARR14(2)
                                                <---------RVE1(2)
                                                <---------ARR14(2)
                                                <---------GATA12
                                         <---------YAB5
                                         <---------YAB1
                                       --------->YAB1        --------->At4g35610     ------>ZmHOX2a(1)
                                     ===============HOX2a_HOX2a                     XXXXXXXXXXXXXXXX
    --------->ANAC58                 ===================HOX2a_HOX2a        <---------ANAC58
    --------->ANAC58      <---------CCA1(2)     --------->GATA12       <---------ANAC58           --
------->ANAC58            <---------At4g35610------>ZmHOX2a(2) <-----------HVH21<---------At4g35610-
------->ANAC58           ------->TEIL------>ZmHOX2a(1)   --------->RVE1(2) <---------ANAC58     ----
-----REM1(2)     <-----------GT1     ====================HOX2a_HOX2a   <---------ANAC58         ----
 
cacgctcacgctcttctatataactctgcatctctctctccttcatgatccgatcttgtatatcagcgtcaagtgcttgcttaagctcctccacaaactt  7553200
            --------->WOX13(2)
          <---------AHL12(3)
          --------->AHL25(2)
          <---------AHL25(1)
          --------->AHL25(1)
          --------->AHL25(3)
          <---------AHL25(3)
          <---------AHL20(2)
          --------->AHL12(3)
          --------->AHL20(2)
         <---------AHL20(3)
         --------->AHL20(3)
         --------->AHL12(3)
         <---------AHL20(2)
         <---------AHL20(1)
         --------->AHL20(2)
         <---------AHL25(2)
         --------->AHL25(1)
         --------->AHL25(3)
         --------->AHL25(2)
         <---------AHL25(1)                                            ------>ZmHOX2a(1)
       <---------WOX13(2)                                          ------>ZmHOX2a(1)
       --------->WOX13(2)                                        <---------DOF5.7(1)
  --------->AtMYB61                                       --------->ARR11(3)
 --------->MYB46(3)                --------->ANAC58       <-----------ARR10
XXXX>MIR865-3P                     --------->ANAC58       <---------ARR11(3)               ---------
------->MYB46(3)     ----------->RAV1(1)                  --------->GATA12           --------->At4g35610
-------->ANAC46     ----------->HVH21                     --------->RVE1(2) --------->ANAC46
----->ARR11(2)     <---------At4g35610       <-----------GT1    ------>ZmHOX2a(1)--------->ANAC46
----->RVE1(2)      --------->At4g35610 --------->KAN1    <---------GLK1(2)--------->ZAT6 <---------ALFIN1
 
atccaccactaatttaattctcagcgacatcgtcttcgaagcaaattctaactatatacaaaatctcctccttcctcacactaaacgctgctacacataa  7553300
                                                    --------->MYB52(1)
                                              <----------DOF2
                                              <---------DAG2
                                          <------NtERF2
                                          --------->ATERF1(1)
                                          --------->DEAR4(2)
                                          --------->RAP2.3(1)
                                         <---------RAP2.3(1)
                                         <---------RAP2.6(1)
                                         <---------ORA47(2)
                                         <---------RRTF1(1)
                                         <---------ERF1
                                         <---------DEAR4(2)
                                         <---------ATERF1(1)
                                         ------>NtERF2
                                        --------->DEAR3(1)
                                        <---------RRTF1(2)         <---------ARR11(3)
                                        <---------DEAR3(1)         --------->ARR11(3)
                                        <---------RRTF1(3)         <---------ARR14(2)
                                       <---------ABI4(1)           <---------GATA12
                                       --------->ATERF1(1)    <---------ARR11(2)
                                      <---------RAP2.3(1)     --------->GLK1(2)
                                    <---------At5g28300 <------NtERF2 <----------DOF2
                                    --------->SPL7(1)  ------>NtERF2 ------>ZmHOX2a(2)             <
                                   --------->MYB52(1) <---------DEAR3(1)                <---------ANAC46
                                 <---------ANAC58  ----------->HVH21 <---------DOF5.7(1)<---------ANAC55(2)
                                 <---------ANAC58 --------->DEAR3(2)<------ZmHOX2a(2)   --------->ANAC55(2)
                          <---------MYB52(1) <---------DOF5.7(1)   --------->GATA12     <---------ANAC58
                        <---------ANAC58<---------RAP2.3(3)   <---------ARR14(2)        <---------ANAC55(1)
          ------>ZmHOX2a(1) <----------DOF2 ------>NtERF2    <---------GLK1(2)      <---------ANAC58
        <---------DOF5.7(1)<---------DOF5.7(1)<---------DOF5.7(1)  --------->ARR14(2)   <---------ANAC58
>ANAC46------>ZmHOX2a(1)<---------ANAC58<---------RAP2.3(2) --------->KAN1          <---------ANAC58
 
atacaatctcctccttcttctggttttccgtcttttacttacggcggcgctttaccgacggcgagattccgatcttttctcgttgaagcttgcgtgagaa  7553400
                                                                                           <--------
                                                                                       ------>NtERF2
                                                                                      --------->ZAT18
                                                                                 ---------->DOF2
                                                                                 --------->DOF5.7(1)
                                                                             <---------AHL12(2)
                                                                            <---------AHL25(3)
                                                                            --------->AHL20(2)
                                                                           <---------AHL12(3)
                                                                           --------->AHL12(3)
                                                                           --------->AHL25(3)
                                                                           <---------AHL25(1)
                                                                           --------->AHL25(1)
                                                                           <---------AHL20(2)
                                     --------->AHL12(2)                    --------->AHL12(1)
                             <----------DOF2           *TSS                <---------AHL12(1)
         <----------ID1 --------->ANAC58      <---------DOF5.7(1)          --------->AHL20(2)
       --------->DOF5.7(1)  <---------DAG2   <---------At4g35610          <---------AHL12(2)  <-----
      --------->DOF5.7(1)   <---------DOF5.7(1)<----------DOF2            --------->AHL12(2)<-------
     ---------->DOF2    --------->ANAC58  <-----------GT1          ----------->GT1    <---------ZAT18
 <------ZmHOX2a(1)      --------->ANAC46 <-----------GT1          --------->ALFIN1--------->DOF5.7(1)
---------TOE2(3)  --------->KAN1  ---------->ID1      <---------YAB5----------->GT1--------->DOF5.7(1)
 
ctgaggaagaaagggacagagacattcacgaccttttgtttttttttccgctttctaatcttcttcagagtgggaaaaataaataaaagcgggctcttat  7553500
                                          --------->At4g35610
                                          <------NtERF2
                                        <-----------RAV1(2)
                                     ----------->HVH21
                                   =================RAV
                                   <-----------RAV1(1)
                                   --------->ALFIN1
                                  <-------MYC3
                                  ------->MYC3
                                  ------->MYC4 <----------DOF2
                                  <-------MYC4--------->GATA12
                                  <-------MYC2<---------RVE1(2)
                                  ------->MYC2<---------ARR11(2)
                                 =========================bZIP_DOF
                                 --------->TGA1a
                                 <---------TGA1a
                                 --------->O2 <---------GLK1(2)
                                 <---------O2 <---------ARR14(2)
                                 --------->ANAC55(2)           ----------->GT1
                           <-----------HVH21  --------->ARR14(2)
     <------------CBF     --------->ANAC46<---------At4g35610 ----------->GT1
-DOF5.7(1)            --------->YAB1 --------->ALFIN1        ------->MYC3
-------CBF      ------->TEIL     <---------ANAC55(2)         *TSS      --------->TOE2(3)
--YAB1        <---------ZAT14  <---------ALFIN1<---------KAN1<-------MYC3            <----------DOF2
 
tgggcctatattgggcctgtacttaacataagtcacacgtgtggcagcggatttttggattacacatgttaaaaacttaaaattagggctttgtgtttcg  7553600
                                 xxxxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                 <---------ANAC58
                                 <---------ANAC46
                                 <---------ANAC58
                      <---------WOX13(2)
                    <---------AHL25(1)
                    <---------YAB1             <------NtERF2
                    <---------AHL20(2)        --------->LBD16
                    --------->AHL25(1)       <---------ANAC46
                    <---------AHL12(3)       <------NtERF2
                   --------->AHL25(2)       --------->LBD16
                   --------->AHL25(3)       ------>NtERF2
                   <---------AHL25(2)       --------->At4g35610                                 <---
                  --------->CCA1(2)         <---------LBD16                                    <----
                 --------->ARR11(3)  <---------ANAC58                     --------->YAB1    <-------
                 <---------ARR11(3)  <---------ANAC58             --------->At4g35610 <---------YAB5
   --------->HSFB2a(2)--------->WOX13(2)   --------->DEAR3(1)--------->KAN1     <-------TEIL--------
 
cttcttctcaaaccctagaagatataattgagactggcttgcttagccgcggagaactcagaactcattcgctgcaaacatggttcgtaatcttcgtctc  7553700
                             <-----------HVH21
                             <-----------TGA1
                            --------->ANAC55(2)
            --------->ARR14(2)                                                                     -
            <---------ARR14(2)                                                                    --
            --------->ARR11(2)                                                                    --
         --------->ANAC55(2)<---------ANAC55(2)                                                   <-
-------DOF2 <---------ARR11(2)   --------->ANAC55(2)                                            <---
-----DOF5.7(1)              <---------ANAC46                                                   -----
--CCA1(2)<---------ANAC55(2)<---------ANAC58         <---------RVE1(2)                 --------->LBD16
-->ID1   <---------ANAC46   <---------ANAC58<---------AtMYB61---------->ID1          <---------LBD16
 
tttctctaagtctcgtattcacaagcgtattgcgtcatgtgtttgttttggttttggatagtttgtctccatctgtgaattcattttgtgcgggattata  7553800
                                               <---------YAB1
                                   --------->ATHB12
                                   <---------ICU4
                                   -------->HAHB4
                                  <---------YAB5
                                  <---------YAB1                                 ----------->GT1
     <----------DOF2              <---------ATHB51               <---------GLK1(1)
    <---------DOF5.7(1)           --------->ICU4  <---------TOE2(3)             ------>ZmHOX2a(2)
-------->RVE1(1)                 <---------WOX13(2) --------->YAB5             <------ZmHOX2a(2)
------->RVE1(2)                --------->AHL20(2) <---------TOE1(3)   <----------DOF2
------->ARR11(3)        <---------ARR11(2)  <---------YAB5  ----------->GT1   <---------GATA12
--------ARR11(3)       --------->GLK1(1)    --------->ICU4 --------->DAG2     --------->GATA12
------AHL20(2)         <---------KAN1<---------ANAC46     ---------->DOF2  <---------ZAT18         <
---->AHL20(2)   --------->STY1(2)--------->WOX13(2)--------->ICU4--------->GLK1(1)          <<<<<<<<
 
aaatctctctttgtaatctagatagcatttccatgtaattatgggtaattgttaatgtttataaagtgaattcctttgtgcgatctgtaaaatgggttag  7553900
                ---------->DOF2                         <---------ANAC58
            ===================HOX2a_HOX2a              <---------ANAC58
            ------>ZmHOX2a(2)           --------->CCA1(2)                                <---------ANAC58
           ====================HOX2a_HOX2a         ----------->RAV1(2)                   <---------ANAC58
           <------ZmHOX2a(2)           <---------ARR14(2)                          --------->ARR11(3)
          --------->ARR11(3)           <---------ARR11(2)                          <---------ARR11(3)
          <---------ARR11(3)           --------->ARR14(2)  --------->KAN1    <---------ANAC58
          <---------GATA12    --------->WOX13(2)  ------>MYB83               =======================
  <---------RVE1(2)     <------ZmHOX2a(1)    <-----------GT1                 <---------ANAC46
  --------->ARR11(3) --------->CCA1(2) --------->ARR11(2) <---------MYB52(1) <---------ANAC58
---------WOX13(1) --------->DOF5.7(1)  <---------RVE1(2)<---------ANAC46     <---------TGA1a
<MYB98    --------->GATA12    <---------WOX13(2)  ------>MYB46(1)         ----------->HVH21
 
ggattgatattgagatctcaaaagataggactcaattagtcagatatgaaacctccctggcgttattctcttgttctgtgacttgaggtcttgagtgatg  7554000
                                               <---------YAB1
                                             <---------AHL20(2)
                                            <---------YAB1  --------->GLK1(2)
                                            --------->AHL25(3)
                                           <---------AHL20(3)
                  --------->YAB1           --------->AHL12(3)
             <---------At4g35610           --------->AHL25(1)         --------->ANAC58
         <---------WOX13(1)                --------->AHL20(3)         --------->ANAC58
       --------->ATHB12                    <---------AHL12(3)         --------->ANAC46
      <---------YAB5                       --------->AHL12(2)  <----------DOF2
<----------DOF2  <---------YAB1         <---------RVE1(2) --------->KAN1
===========bZIP_DOF    <---------YAB5 <---------YAB1     <---------RVE1(2)
 
agacttttagtgattgagctattataaacatttattgtgttttgatttttatttttgttcgatattcttttgcaggcaagaggtttgaagaagcatttga  7554100
<- Previous    Next ->

AGI:  At2g17350.1   
Description:  similar to hypothetical protein [Vitis vinifera] (GB:CAN62847.1)
Range:  from: 7552620    to: 7553456    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g17360.1   
Description:  40S ribosomal protein S4 (RPS4A). Identical to 40S ribosomal protein S4-1 (RPS4A) [Arabidopsis Thaliana] (GB:Q93VH9;GB:Q7XJS7); similar to 40S ribosomal protein S4 (RPS4B) [Arabidopsis thaliana] (TAIR:AT5G07090.1); similar to 40S ribosomal S4 protein [Glycine max] (GB:AAM93434.1); contains InterPro domain RNA-binding S4; (InterPro:IPR002942); contains InterPro domain Ribosomal protein S4e, N-terminal and RNA-binding (InterPro:IPR013844); contains InterPro domain Ribosomal protein S4e, N-terminal (InterPro:IPR013843); contains InterPro domain Ribosomal protein S4e, central (InterPro:IPR013845); contains InterPro domain KOW (InterPro:IPR005824)
Range:  from: 7553562    to: 7555395    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version