AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                             --------->YAB1
                                                          ------->TEIL
                                                      <---------WOX13(2)                    --------
                                                      --------->WOX13(2)               ------>ZmHOX2a(1)
                                                     ------>MYB83                      =============
                                                     ------>MYB46(1)          ================HOX2a_HOX2a
                                                   <---------MYB59           <---------ARR11(3)
                         ------>MYB46(1)        <-----------GT1--------->ICU4--------->ARR11(3)    -
             ----------->RAV1(1)             <---------ANAC55(2)    --------->MYB52(1)--------->TOE2(3)
   --------->YAB5        ------>MYB83        --------->ANAC55(2)  <---------YAB5 --------->KAN1    <
  <---------YAB1       --------->TOE1(2)     --------->ANAC55(1)<---------ICU4<------ZmHOX2a(2)    -
 
tatacatgattcaaaaccacatataacctacaaaaacaattgaacaacatgtaacctaatgaactcataatcaacgaagagatcatattcctcagaatca  2590100
                                                                                                   =
                                                                                                   -
                                                                                                  --
                                                                                                  <-
                                                                                                 ---
                                         <------ZmHOX2a(2)                                       <--
                                        <---------ARR11(3)                                       <--
                                  <-----------GT1                                                ---
                               <---------ICU4                                                    ---
                              --------->ICU4                                                     ---
                             <---------AHL25(2)                                                  ---
                             <---------AHL20(3)                                                  <--
       <---------GATA12      <---------AHL12(3)                           <-----------GT1       ----
   <---------WOX13(2)        --------->AHL20(3)                         --------->WOX13(2)     -----
   --------->WOX13(2)        <---------AHL20(2)                         <---------WOX13(2)  <-------
->RVE1(2)------>ZmHOX2a(2)   --------->AHL12(3)       <------ZmHOX2a(2)<---------ICU4     ----------
================HOX2a_HOX2a --------->YAB1      --------->TOE1(2)      --------->YAB5  --------->ANAC58
-------->TOE1(3)         --------->YAB1 --------->RVE1(2)          <-----------GT1     --------->ANAC58
---------MYB59         ----------->GT1  --------->ARR11(3)    <---------AHL12(1)       --------->ANAC46
-------->TOE2(3)    <---------ATHB12    <---------GATA12      <---------KAN1        --------->WOX13(2)
 
aacctaaattgatctaatttcaaatcaagtataaaaattacaagatcaaaacttgcgatcatcgaatatttcactaattacaaactcaataagcaacaca  2590200
<---------ETT(1)
----------->HVH21
====================================HOX2a_HOX2a
----->ZmHOX2a(2)
------->CCA1(2)                           --------->LBD16
-----ZmHOX2a(2)                          <---------ANAC46
------>AGP1                             <---------LBD16
-------ARR11(2)                       --------->TOE1(2)                                -------------
-------GATA12                         --------->TOE2(2)                       --------->ATHB12
------>RVE1(2)                       ----------->RAV1(2)                      --------->YAB5   -----
------>GATA12                       --------->GLK1(2)                        <---------YAB1   ------
------>ARR11(2)                     ------->TEIL            --------->LBD16<---------ICU4     ------
------>ARR14(2)                    --------->ARR11(3)     <---------HSFB2a(2)<---------YAB5  -------
-------ARR14(2)         --------->DOF5.7(1)            <----------DOF2     --------->YAB1    -------
----->KAN1--------->ANAC58     <---------KAN1      ---------->ID1         <---------YAB5    --------
------>ARR10          ---------->DOF2<---------HSFB2a(1)  --------->HSFB2a(2)--------->ICU4 --------
--ALFIN1--------->CCA1(2)--------->DOF5.7(1)      <-----------GT1         --------->ICU4<-----------
->RAV1(1) --------->ANAC58   <------ZmHOX2a(1)  --------->KAN1          --------->YAB1 -------------
 
gatccgacaagagacgaaatcgagagaaaggaggataagaacctgcgggagtttttcgctttccgaagattgaattcatcatgattcaataccgaaaaag  2590300
                                                                                           ---------
                                                                                         <---------AHL20(3)
      --------->TOE1(2)                                                                  --------->AHL20(2)
    --------->GATA12                                                                     <---------AHL20(2)
    --------->ARR14(2)                                                                   <---------AHL12(3)
    --------->GLK1(2)                                                                    --------->AHL20(3)
    <---------ARR14(2)                     <------NtERF2                                 --------->AHL12(3)
    <---------GATA12                      ------>NtERF2                                <---------AHL12(2)
---->AG                                  <---------DEAR3(1)                            <---------YAB1
------>GT1                               <----------ID1                               <---------AHL20(3)
--->DAG2                              <---------TOE2(3)                               --------->AHL25(2)
--->DOF5.7(1)                     --------->WOX13(2)                                  --------->AHL20(3)
-->DOF5.7(1)                      <---------WOX13(2)                                  <---------AHL12(2)
-->DAG2                       --------->ANAC58                                        <---------AHL25(2)
-->DOF2                    <---------WRKY18(1)                         ----------->GT1--------->AHL12(2)
->DOF5.7(1)       <---------HSFB2a(2) --------->DOF5.7(1)        ------>ZmHOX2a(2)   --------->AHL25(3)
----AGL15         --------->HSFB2a(2)---------->DOF2      --------->TOE2(3)          --------->AHL12(1)
---->AGL1    <----------DOF2  --------->ANAC58  <---------KAN1 <---------RVE1(2)     <---------AHL12(1)
 
gtgaacaaatctgggacttttgtagaagcttgaacgaaattaaggcgacgaattagcaaaacctttgatcggagttgaaaaatcgagattatttttatat  2590400
                                      ---------->DOF2
                                      <---------ARR11(2)
                                   <---------ANAC55(2)
                            --------->ANAC46
                            --------->ANAC55(2)   <---------AHL12(3)
                         --------->ARR11(1)       --------->AHL12(2)
                         <---------RVE1(2)        <---------AHL20(2)
                         --------->ARR14(2)       --------->AHL25(1)
                         <---------ARR11(2)       <---------AHL25(2)                           <----
        <---------HSFC1(2)--------->ARR14(1)     --------->AHL12(1)                            -----
        --------->At4g35610 --------->ANAC58     <---------AHL12(1)                           <-----
        <---------HSFB2a(1) --------->ANAC58  --------->YAB5          <---------ANAC58       <------
        --------->HSFB2a(1) <---------ANAC55(2) <------------------------ANAC81              -------
        --------->HSFC1(2)--------->CCA1(2)   --------->ATHB12        <---------ANAC58      --------
        --------->ZAT2   --------->ARR11(2)  <---------KAN1      <---------DOF5.7(1)      ----------
        <---------At4g35610<-------TEIL--------->DAG2           <----------DOF2           ----------
       ------->TEIL      <---------ARR14(2)  <---------YAB5     <---------DOF5.7(1)      --------->RVE1(2)
  --------->CCA1(2)     --------->CCA1(2)    --------->ICU4    <---------DOF5.7(1)  --------->AHL20(2)
>AHL20(2)       <---------DEAR3(1)>>>>>>>>>>AtSR1*TSS    <-----------GT1            <---------AHL20(2)
 
agaagagacgaagcttccttcggtgagagatacgaaacgcgtaaaggaatgatttttttttttcttccttttttcttgagaagtttttttaatatcaatt  2590500
                                                                            --------->YAB1
                                                                           <---------ATHB12
                                                                           <---------YAB5
                     <---------TOE2(3)                              <----------DOF2
                 <---------AHL12(2)                                <---------DOF5.7(1)
                 <---------WOX13(2)                           --------->ARR11(3)
                 --------->WOX13(2)                           <---------ARR11(3)
     --------->GLK1(2) <------------CBF                       --------->RVE1(2)
   --------->MYB46(3)<---------YAB5                           --------->ARR14(2)
  ------------>CBF   <---------YAB1                          --------->RVE1(1)
-----ICU4        --------->AHL12(2)                         --------->AHL25(2)
---->YAB1       --------->ATHB51                            <---------AHL25(2)
----ATHB51      <--------HAHB4                             <---------AHL20(3)                 <-----
---WOX13(2)     <---------ICU4                             --------->AHL20(3)                -------
-->WOX13(2)    <---------YAB1             <----------DOF2  --------->AHL12(3)                <------
->WOX13(1)     --------->ICU4          <-----------GT1------>ZmHOX2a(1)  <-----------GT1 --------->KAN1
-->CBF <---------DOF5.7(1)          --------->YAB1   --------->TOE2(3)  <---------AHL20(2)  <-------TEIL
------->AGL3 --------->YAB1        --------------------->WRI1--------->CCA1(1)      --------->YAB5
 
atagcaacaatctttctcataattaacattggagacctcttataacttttggacctccttaaaaatatcttctttttaatcatactacgatgatgttcgt  2590600
                                                                          <---------AHL12(2)
                                                                          --------->AHL12(2)
                                                                          <---------YAB1
                                                                         <---------AHL20(3)
                                                                         <---------AHL20(2)
                                                                         --------->AHL20(3)
                                                                         <---------AHL25(2)
                                                                         --------->AHL12(3)
                                                                         --------->AHL12(2)
                                                                         <---------AHL20(1)
                                                                         --------->AHL25(2)
                                                                        --------->AHL12(1)
                                                                       --------->AHL25(3)
                                                                       <---------YAB1
                                                                      --------->AHL12(2)
                                                                      --------->AHL12(3)
                                                                      <---------AHL25(2)
                                                                      --------->AHL25(2)
                                                                      <---------AHL20(3)
                                                                      --------->AHL20(3)
                                                                    <---------AHL20(2)
                                                                    <---------YAB1
                                                                    --------->AHL25(1)
                                                                    --------->AHL25(2)
                                                                    --------->AHL25(3)
                                                                    <---------AHL20(3)
                                                                    --------->AHL20(3)
                                                                    --------->AHL12(3)
                                                                    <---------AHL12(3)
                                                                   --------->AHL12(2)
                  ------->TEIL                                     --------->AHL12(3)
               <---------KAN1                                      <---------AHL25(2)
            --------->LBD16                                        --------->AHL25(2)
          <---------LBD16                                          <---------AHL20(3)
     ------>ZmHOX2a(2)                                        <---------AHL20(2)
    <------ZmHOX2a(2)                                         --------->AHL20(2)
   <-----------ARR10                                       <---------AHL12(1)
   <---------AGP1<-----------GT1                           --------->AHL12(1)
   --------->ARR11(3)                                      <---------AHL25(1)                     --
   --------->ARR14(3)                                      <---------AHL20(2)                     <-
   --------->GATA12                                        <---------AHL20(3)                     --
   --------->RVE1(2)                                       --------->AHL25(1)                     --
   <---------ARR14(2)                                      --------->AHL25(2)                     <-
   --------->ARR14(2)                                      <---------AHL25(2)                   ----
   <---------GATA12                                        --------->AHL20(3)                   ----
   <---------ARR11(3)                                      --------->AHL20(2)                   <---
   <---------ARR14(3)                                     --------->AHL12(1)     <----------DOF2----
--GAMYB--------->KAN1 <---------MYB52(1)                  <---------AHL12(1)<---------AHL20(2)  <---
-->MYB52(2)--------->HSFB2a(2)                      ---------->DOF2--------->AHL20(3)          <----
---MYB46(3)<---------HSFB2a(2) <---------KAN1 --------->RVE1(2)    <---------AHL20(1)       <-------
 
tgtgaagatctcatccggatgaaccgttcttagaacatgggcaatatagtatcacaaaagaattttttaatattattattttttctttaactcaactttc  2590700
          <---------TOE2(2)
  --------->YAB1
<---------WOX13(2)
--------->WOX13(2)
------->AHL25(3)
--------AHL25(1)
------->AHL25(1)
------->AHL20(2)
--------AHL20(2)             <---------TOE1(3)
----->TOE2(3)                <---------TOE2(3)
----->WOX13(2)  <---------YAB5            ----------->RAV1(2)
------------AGL15        <---------WOX13(2)                                 --------->DOF5.7(1)
----------->AGL15   <---------ZAT6       <---------GATA12              ----------->GT1    <---------KAN1
------WOX13(2)  --------->ICU4         <-------TEIL                xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
-------------AGL3<---------ICU4<------ZmHOX2a(1)                --------->TOE1(2)   ---------->DOF2
---DOF2   ------->TEIL   --------->WOX13(2)         <---------YAB1 --------->DOF5.7(1)  <---------GLK1(2)
 
attaattagaacgtatgtaatcagtgtgaattaaggatgaaatacatctggggacataatagaagaacataagatggaaaaaacccaaaaagaatttcaa  2590800
                                                                                           <--------
                                                                                          <---------AHL20(2)
                                                                                          --------->AHL25(3)
                                                                                          <---------AHL25(1)
                                                                                          --------->AHL25(1)
             --------->YAB5                                  --------->AHL20(2)  <xxxxxxxxxxxxxxxxxx
             ----------->GT1                                 <---------AHL20(2)------->GAMYB
    <---------AHL20(2)                                 ----------->GT1      <-----------GT1<--------
   --------->AHL25(3)              <<<<<<<<<<MYB80  --------->ANAC58       <-----------GT1--------->AHL20(2)
   <---------AHL20(2)     <---------YAB5            --------->ANAC58      --------->AHL20(2)     ---
  --------->AHL12(2)      <---------ATHB12          --------->ANAC46 <---------ZAT18    --------->WOX13(2)
  <---------AHL12(2)--------->RVE1(2)              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)<---------WOX13(2)
 
ctattttttatttggacgtttaatatccaatcgtttttggtttgaagataaatacacgaagtaataaaactgtgcaatttaacacccagacaattaaatg  2590900
                                                                                                 <--
                                                                                                ----
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                              <-----
                                                                                             <------
                                                                                             <------
                                 <---------AHL25(1)                                          <------
                                 <---------AHL25(3)                                          -------
                                 <---------AHL12(2)                                          <------
                                 --------->AHL12(3)                                          <------
                                 <---------AHL20(2)                                          -------
                                --------->AHL25(2)                                           <------
                                --------->AHL20(2)                      <---------AHL12(2)  --------
                                <---------AHL20(1)                      --------->AHL12(2)  <-------
                                --------->AHL20(1)                     <---------AHL12(3)   <-------
                                --------->AHL25(3)                     --------->AHL20(3)   --------
                                <---------AHL25(2)                     --------->AHL12(3)   --------
                                --------->AHL12(3)                     <---------AHL25(1)   <-------
                                <---------AHL25(1)                     <---------AHL20(3)  ---------
                                <---------AHL20(2)                     <---------AHL20(2)  <--------
                             --------->YAB1                            <---------AHL25(3)  ---------
                 <------ZmHOX2a(2)                                     <---------AHL25(2)  ---------
                <---------GATA12--------->AHL25(1)                    --------->AHL25(3)   ---------
                --------->RVE1(2)--------->AHL25(2)             <-----------GT1            ---------
      --------->YAB1--------->YAB1               --------->TOE1(3)    <---------AHL20(2)   <--------
  xxxxxxxxxxxxxxxx>smallRNA(i)  <---------AHL12(3)             --------->AHL20(2)       <---------ARR11(3)
 xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)            --------->ANAC46     --------->AHL20(2)--------->ARR11(3)
-AHL20(2)       --------->GATA12<---------AHL25(3)           <---------WOX13(2)        --------->YAB1
xxxxxsmallRNA(le3)------>ZmHOX2a(2)              --------->TOE2(3) xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-AHL25(3)       <---------ARR11(3)               <---------DOF5.7(1)  --------->AHL25(1)<---------RVE1(2)
-------->GT1    --------->ARR11(3)           <-----------GT1 --------->WOX13(2)       <---------YAB1
 
ttgttattttcatactcacgatctcataacaaaaataaaattccaattttacccttaacatctcaattaactattaatttttagatggtatgatattaat  2591000
<- Previous    Next ->

AGI:  At2g06530.1   
Description:  VPS2.1. similar to VPS2.3 [Arabidopsis thaliana] (TAIR:AT1G03950.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN80030.1); contains InterPro domain Snf7; (InterPro:IPR005024)
Range:  from: 2588542    to: 2590450    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version