AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                     ---------->DOF2
                                                              --------->ANAC58
                                                              --------->ANAC58
                                                              --------->DAG2               ---------
           --------->TOE2(3)                                  --------->ANAC46             <--------
           --------->TOE1(3)      --------->REM1(1)          ---------->DOF2            ---------->DOF2
   --------->DOF5.7(1)     --------->DOF5.7(1)           ------>ZmHOX2a(2)      <----------DOF2-----
 ---------->DOF2         ---------->DOF2               --------->GATA12         --------->TOE2(3)  -
 
agaagaaagagataccttagagtttagccaaagggcttcatcaaattcaccagggtttgatccataaggcacaaaagcagcaactttagaagaaagctga  1584300
                                                                                                  --
                                                                                                  <-
                                                                                                 ---
                                                                                               <----
                                                                                             ------>NtERF2
                                                         --------->ARR14(2)              --------->ANAC58
                                                         <---------ARR14(2)              --------->ANAC58
                                                        --------->WOX13(1)             <-----------GT1
                                            <------ZmHOX2a(2)                        <---------AHL20(2)
        <-----------GT1                     ========================HOX2a_HOX2a    <---------WOX13(2)
>At4g35610                                 --------->GATA12                        --------->WOX13(2)
-At4g35610 <----------DOF2                 <---------RVE1(2)            <---------GLK1(2)--------->ANAC46
---->RVE1(2)              ---------->DOF2  --------->ARR11(3)          --------->KAN1--------->AHL20(2)
--------->DOF2 ---------->ID1              <---------ARR11(3)------>ZmHOX2a(1)    --------->WOX13(1)
 
tcaaaagtatataactttgtctcttcatcaaaagacttcatcttgagatcatcaagagtcaatcctctaatcccacattctccatcaattaaacgcctcc  1584400
        --------->ANAC58
        --------->ANAC58                       <------ZmHOX2a(1)
        --------->ANAC46                   ------>MYB83
----->MYC3                                 ------>MYB46(1)
------MYC3                 <-----------GT1 -------->P                                              -
------>ANAC46         --------->ZAT14      --------->MYB52(1)                              <--------
-----ALFIN1          --------->ALFIN1  --------->GATA12     <---------KAN1          <---------KAN1 <
 
acgttgtttcaacgcctctaccaagtggagtcaccatgcctagacctacaggaacaatgtcgaatcagagaaattacagagataagtatatgtgaataca  1584500
                                              --------->YAB5                            ------>NtERF2
                                              --------->ATHB12                        --------->ATERF1(1)
                                             <---------YAB5                           <------NtERF2
                                 --------->ANAC46                               <---------LBD16
<---------AtLEC2            --------->MYB46(3)--------->YAB1                    <---------At4g35610
------>TEIL           ----------->HVH21     <---------WOX13(1)      ---------->DOF2  <---------ATERF1(1)
-ARR11(2)           ----------->GT1    <---------ANAC46            <---------REM1(1)<---------DEAR3(1)
-------TEIL   <------ZmHOX2a(1)<---------ALFIN1        >>>>>>>>>TBF1================================
 
tgtacatggagagagaaggagaccagtgacaacaacacggcgatgtgaatgataagaagaagaagtagagatgaagcggtttaagcggaggcgacttgcg  1584600
                                                       <------NtERF2
                                                      ------>NtERF2                            <----
                                                   <---------ATERF1(1)                    <---------AHL25(1)
                                                 --------->ATERF1(1)                      --------->AHL25(1)
                                                <---------ATERF1(1)                       <---------AHL12(3)
                                            <---------ANAC46                              <---------AHL20(2)
         --------->LBD16       <---------At5g28300----------->HVH21                       --------->AHL20(2)
        --------->ANAC46    <-----------HVH21  --------->ARR11(2)                         --------->AHL12(3)
       <---------LBD16  <------NtERF2    ----------->HVH21                             <---------GATA12
     --------->ETT(2)  ------>NtERF2     ----------->TGA1           <----------DOF2 *TSS  --------->AHL25(3)
--------->TGA1a       <---------ETT(2)  <-----------HVH21   --------->ATHB12      <---------LBD16
=================================================MYC_MYB   <---------YAB1     --------->AHL25(1)
<---------TGA1a       --------->ETT(2)<---------DEAR3(1)   --------->ICU4     <---------AHL12(1)
--------->O2       <---------REM1(1)------------>AtMYB77<---------DEAR3(1)    --------->AHL12(1)
<---------O2      --------->GATA12 --------->DEAR3(1)<---------DEAR3(1)       <---------AHL20(2)  --
==========bZIP_DOF<---------GATA12 ----------->HVH21--------->ATERF1(1)      <---------KAN1 --------
 
ctcaagtgtctacggagattagatgtcgccatttcacagcgacggtgacggagacgacggcgatgatgggactttttagaatttatcagggatttaaatt  1584700
                                                                   <---------GLK1(2)
                                                               <---------WOX13(2)
                                                               --------->WOX13(2)
                                                              <---------AHL25(3)
                                                             --------->AHL12(1)
                                                             <---------AHL12(1)
                                                             <---------AHL20(2)
                                                             --------->AHL20(1)
                                                             --------->AHL25(3)
                                                             <---------AHL25(3)
                                                             <---------AHL25(2)
                                                             --------->AHL25(2)
                                                             <---------AHL12(3)
                                                             --------->AHL25(1)
                                                             <---------AHL25(1)
                                                            --------->AHL25(1)
                                                            --------->AHL25(3)
                                                            <---------AHL25(2)
                                                            --------->AHL20(2)
                                                            <---------AHL12(3)
                                                           <---------WOX13(2)
                                                       ----------->GT1              --------->DOF5.7(2)
                                                 <---------KAN1<------------CBF    --------->TOE2(3)
                                                 ---------->DOF2<---------WOX13(1) --------->TOE1(3)
                                           ------>MYB46(1) --------->AHL12(2) <---------AHL20(2)
                    --------->MYB52(1)     --------->MYB52(1)--------->AHL20(2)  <---------YAB5
      <---------ARR11(3)                   ------>MYB83--------->LBD16  --------->AtLEC2           -
      --------->ARR14(2)       --------->YAB1   <---------MYB52(1) <---------RVE1(2)<---------MYB52(1)
   --------->HSFB2a(2)<---------ATHB12  ------------>CBF<------NtERF2 <---------ANAC58            <-
 ------>ZmHOX2a(1)--------->MYB46(3)    --------->MYB46(3) --------->WOX13(2) <---------AHL12(1)  --
---TEIL--------->CCA1(2)      <---------YAB5<---------ATHB12--------->AHL12(2)--------->AHL12(1) <--
-------->ID1      ------------>CBF --------->WOX13(2) --------->RAP2.6(2)     --------->KAN1   -----
->KAN1<---------RVE1(2)----------->GT1<-----------GT1<---------LBD16  <---------ANAC58         -----
 
cgtcctctagatatgaagttaaccaatggtttaatcatatttaaccaatcggttaagccggaaattaattgattcttgcaaataatcgttaaccagactg  1584800
             --------->ZAT18
  --------->YAB1                                                                             -------
  <---------ICU4                                                                            <-------
 <---------ATHB12         <----------DOF2                                                  <--------
 <---------YAB5           <---------DAG2                       <-----------GT1             <--------
-------->YAB1<---------ZAT14                                --------->MYB52(2)           --------->DEAR3(2)
--------AHL12(1)      <------ZmHOX2a(1)      ----------->RAV1(1)                        --------->SPL7(1)
------->AHL12(1)  --------->ZAT14         ----------->RAV1(1)<---------WOX13(2)  <---------ALFIN1
-------WOX13(1)   <---------ZAT14      --------->ANAC58 ----------->GT1         --------->ANAC46   -
---->ATHB12  <---------ZAT18           --------->ANAC46 --------->YAB5          ----------->HVH21 --
---->YAB5    --------->ZAT14           --------->ANAC58<---------YAB5         ----------------->AGL1
 
attaatcatcaaaccgtgcactgtaggagcttttcgagtcaaacgcgacaacaatggaatggttatttacaatgttttcatgcccgactcggaccgtccg  1584900
                                                      --------->ANAC46
                                                      ----------->HVH21
                                         --------->DOF5.7(1)
      <--------P                         --------->DAG2                         ----------->RAV1(1)
      <---------WOX13(1)     ----------------->AGL1   <---------ETT(1)       --------->ANAC46
    <---------MYB46(3)       <---------LBD16  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
-->SPL7(1)            <---------KAN1     xxxxxxxxxxxxxxxx>smallRNA(i)        <xxxxxxxxxxxxxxxxxxxxxx
--MYB52(1)  <xxxxxxxxxxxxxxxxsmallRNA(i)---------->DOF2                    <-----------GT1
---HVH21   ------>ZmHOX2a(2)<-----------GT1   xxxxxxxxxxxxxxxx>smallRNA(i)--------->DOF5.7(1)
-SPL7(1) <---------RVE1(2) <-----------GT1   ----------->GT1         <----------ID1
---------->HVH21 ------>ZmHOX2a(2)    <---------RVE1(2)              ----------->GT1
------->SPL7(1)<---------GATA12--------->LBD16xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
 
gtccgactggttgatcgtgatccgaacatttttccggtttggataaagtgctaaaacccgacaagttcaaaaacgaaaaaaccccacaaaaactcaccat  1585000
                                                                                                  --
                                 --------->ALFIN1                                               <---
                                 <---------KAN1                                                 <---
                                 ----------->HVH21                                 <-----------GT1<-
                               <---------ANAC58                             <------ZmHOX2a(1)   ----
                               <---------ANAC46                      <---------AHL12(2)        <----
                               <-------GAMYB                       --------->AHL20(3)          <----
                    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)          <---------AHL20(3)        <------
                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)            --------->AHL20(2)       --------
                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)            <---------AHL12(3)       --------
           <xxxxxxxxxxxxxxxxsmallRNA(i)                            --------->AHL20(1)       <-------
      <---------bZIP60(2)      <---------ANAC58                    <---------AHL20(2)       <-------
      xxxxxxxxxxxxxxxx>smallRNA(s)   <---------DEAR3(2)            <---------AHL25(1)       <-------
      <xxxxxxxxxxxxxxxxsmallRNA(i) <------NtERF2                   --------->AHL25(3)      ---------
    <---------WRKY18(1)       xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  --------->AHL25(1)     --------->AHL12(2)
   ----------->HVH21xxxxxxxxxxxxxxxxxxxxx>smallRNA(s2)             <---------AHL25(3)     --------->WOX13(2)
 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)                             <---------AHL25(2) <----------DOF2
xsmallRNA(l2) ------->TEIL <-----------HVH21                       --------->AHL25(2) <---------DAG2
 
taacccatgacctggtgaaccggttgaaccagtcgggtgtcggttttaaaaaactctcttcattttgaaataaaatataggattttatactttatttaat  1585100
         <---------AHL12(1)
         <---------AHL12(2)
         --------->AHL12(3)
         <---------AHL12(3)
         --------->AHL25(2)
        --------->AHL25(3)
        --------->AHL12(3)
        --------->AHL25(1)
        --------->AHL12(1)
        <---------AHL25(1)
        --------->AHL25(2)
        <---------AHL12(1)
        <---------AHL25(2)
        <---------AHL25(3)
        <---------AHL12(3)
        <---------AHL20(2)
       --------->AHL25(1)
       <---------AHL25(1)
       --------->AHL25(2)                                                      --------->AHL12(1)
       <---------AHL12(3)                                                     <---------AHL25(1)
       --------->AHL12(3)                                                     --------->AHL12(3)
       --------->AHL25(3)                                                     --------->AHL25(1)
       --------->AHL20(2)                                                     <---------AHL12(3)
       <---------AHL25(2)                                                     --------->AHL20(2)
------->ICU4                                                                  --------->AHL25(3)
------ICU4                                                                   <---------AHL12(2)
-----HAHB4                                                         <---------RAP2.6(3)
--------YAB1                                                       ------>NtERF2xxxxxxxxxxxxxxxxxxxx
----->YAB1                                                        <---------ANAC58
-----ATHB12                                                       <---------ANAC58
-----YAB5--------->AHL12(1)                                       <---------ANAC46
-----GT1--------->AHL20(2)                      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)              -
->AHL20(2)        ----------->GT1       <---------AHL20(2)      <---------ZAT18<---------AHL20(2)  <
->AHL25(1)        <---------MYB46(3)   --------->AHL20(2)       --------->ZAT14<---------AHL25(3)  <
--AHL25(3)      <---------At4g35610   <---------AHL20(2) --------->ZAT14     --------->AHL12(2)   <x
--AHL25(1)      <-------GAMYB      <---------AHL12(1)    <---------ZAT14    <---------AHL12(2)    <x
--AHL20(2)<---------AHL12(1)       --------->AHL12(1) xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)      <xxx
>AHL20(2)<---------AHL25(3)      <---------RVE1(2)   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)      <xxx
 
catttttaaaaaaaatttcagttgttaaactcatttgatattttaaatttcgacgaagacttcacagtgccgtcttaaaaaataaatcgaatggtgagtg  1585200
<- Previous    Next ->

AGI:  At2g04540.1   
Description:  3-oxoacyl-(acyl-carrier-protein) synthase II, putative. Identical to 3-oxoacyl-[acyl-carrier-protein] synthase, mitochondrial precursor (KAS) [Arabidopsis Thaliana] (GB:Q8L3X9;GB:Q9SJB7); similar to FAB1 (FATTY ACID BIOSYNTHESIS 1), fatty-acid synthase [Arabidopsis thaliana] (TAIR:AT1G74960.1); similar to FAB1 (FATTY ACID BIOSYNTHESIS 1), fatty-acid synthase [Arabidopsis thaliana] (TAIR:AT1G74960.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO24089.1); contains InterPro domain Beta-ketoacyl synthase, N-terminal (InterPro:IPR014030); contains InterPro domain Beta-ketoacyl synthase, C-terminal (InterPro:IPR014031); contains Int
Range:  from: 1581413    to: 1584685    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version