AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                      --------------->AtSPL8                  <---------AHL20(2)
                             <---------AHL12(2)                               <---------AHL12(3)
                             --------->WOX13(2)                               --------->AHL25(1)
                             <---------WOX13(2)                               <---------AHL25(1)
                            --------->AHL12(3)                                --------->AHL20(2)
                            <---------AHL12(3)                                --------->AHL25(2)
                            <---------AHL12(2)                                --------->AHL12(3)
                            --------->AHL25(2)                                <---------AHL25(3)
                           <---------AHL25(3)                                 --------->AHL12(1)
                           --------->AHL25(3)                                 --------->AHL25(3)
                           --------->AHL20(2)                                 <---------AHL12(1)
                           <---------AHL20(1)                   --------->AHL25(2)           -------
                           --------->AHL12(1)                   <---------AHL25(2)          <-------
                           --------->AHL20(1)                   --------->AHL20(2)       --------->AHL12(1)
                           <---------AHL12(1)                   --------->AHL20(3)       <---------AHL12(1)
                           <---------AHL25(1)                   <---------AHL20(3)       --------->AHL20(1)
                           <---------AHL20(2)                <---------AHL25(2)          <---------ARR11(3)
                           <---------AHL25(2)                --------->AHL25(3)          <---------AHL20(1)
                           --------->AHL25(2)                <---------AHL25(1)          --------->ARR11(3)
                           --------->AHL25(1)                --------->AHL25(2)          --------->AHL25(2)
             --------->ANAC55(2)      <---------------AtSPL8 <---------AHL20(1)         <---------AHL12(3)
             <---------ANAC55(2)      --------------->AtSPL3 --------->AHL20(1)         --------->AHL20(2)
       <---------AHL12(1)  --------->AHL12(3)                --------->AHL20(2)         --------->AHL12(3)
       --------->AHL12(1) --------->AHL20(2)                 --------->AHL20(3)         <---------AHL25(1)
    --------->AHL20(2)    <---------AHL12(1)                 --------->AHL25(1)       --------->AHL12(3)
    <---------AHL20(2)    --------->AHL12(1)                 <---------AHL20(3) <---------AHL12(2)
   --------->AHL20(2)     <---------AHL20(2)                 <---------AHL20(2)<---------AHL25(3)
  <---------YAB1          --------->AHL25(3)                 <---------AHL25(3)<---------AHL20(2)
 <---------WOX13(2)       --------->AHL25(1)     <---------AHL12(2)         --------->WOX13(2)
 --------->WOX13(2)       --------->AHL12(3)    <---------AHL20(2)    <---------ANAC55(2)<---------AHL25(3)
-------->AHL25(1)         <---------AHL25(1)    <---------AHL25(3)    ----------->GT1 --------->AHL20(3)
---------AHL25(1)         <---------AHL12(3)   <---------AHL25(1) --------->AHL25(2)  <---------AHL12(3)
---------AHL25(2)     <---------AHL20(2)       --------->AHL25(3) --------->AHL20(2)  <---------AHL20(3)
-------->AHL25(3)     <---------AHL20(3)       --------->AHL25(1) <---------AHL12(3)--------->AHL25(1)
---------AHL20(3)     --------->AHL20(2)       <---------AHL20(2) <---------AHL25(1)<---------AHL12(3)
---------AHL20(2)     --------->AHL25(1)       --------->AHL20(2) <---------AHL25(2)<---------AHL25(1)
-------->AHL25(2)     --------->AHL20(3)       --------->AHL20(3) <---------AHL25(3)<---------AHL20(2)
-------->AHL20(2)     <---------AHL25(1)     <---------WOX13(2)--------->AHL12(2)   --------->AHL20(2)
-------->AHL20(3)<---------RVE1(2)   ---------->DOF2      --------->YAB1    <---------WOX13(2)------
--->ICU4 --------->ARR11(3)<---------AHL12(3)--------->WOX13(2)<---------AHL12(2)   --------->AHL12(3)
 
attttattaaaaaatcatgtgatattaaaataaatttagtaaaagtacaattaaatatgtataataaaataatatgtaaaattaaatataaatatatcat  1281400
                                       <---------WOX13(2)
                                       --------->WOX13(2)
                                     <---------AHL20(2)
                                     --------->AHL20(2)
                                     <---------AHL25(3)
                                    --------->AHL20(2)
                                    --------->AHL25(3)
                                   --------->AHL12(2)
                                   <---------AHL12(2)
                                 --------->ATHB51                              <xxxxxxxxxxxxxxxxxxxx
                                 <---------ICU4             --------->DAG2    --------->YAB1
                                 <---------AHL25(3)       <xxxxxxxxxxxxxxxxsmallRNA(s)
                                 --------->AHL20(2)      <xxxxxxxxxxxxxxxxsmallRNA(i)
                                 <---------AHL25(1)     xxxxxxxxxxxxxxxx>smallRNA(s)
                                 --------->AHL12(1)     xxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                                 <---------AHL12(1)     xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                 <---------AHL12(3)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                 <---------AHL20(2)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                                 --------->AHL25(1)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                 --------->AHL12(3)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                --------->ICU4         xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                --------->AHL25(3)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                <---------YAB5        xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)     <xxxxx
                               <---------AHL12(2)     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)  xxxxxxxx
                               --------->AHL12(2)    --------->KAN1  <---------bZIP60(2)    <xxxxxxx
                               <---------WOX13(2)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3) xxxxxxxxx
                               --------->WOX13(2)   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <xxxxxxxxx
                              --------->YAB1        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3) <xxxxxxxxx
                             --------->AHL25(1)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  <xxxxxxxxx
      <---------RVE1(2)      --------->AHL25(3)  <-----------HVH21--------->ICU4         <xxxxxxxxxx
      --------->GATA12       <---------AHL25(3)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)   xxxxxxxxxxxx
-->YAB5                      --------->AHL20(2)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(l2)   xxxxxxxxxxxxxx
--YAB1<---------GATA12       <---------AHL20(2)------->MYC3xxxxxxxxxxxxxxxx>smallRNA(s)xxxxxxxxxxxxx
--->TOE2(3)                --------->TOE2(3)   <-------MYC3---------->DOF2 --------->WOX13(1)<xxxxxx
 
taaactatagatttgaaattgaagagattacattaattatttaataaacacatgtcaaatgctaaagtgatgatgtgtctatcatatgaagagagttggc  1281500
             --------->WOX13(2)
             <---------WOX13(2)
             --------->AHL12(2)
             <---------AHL12(2)
           <---------AHL25(1)
           --------->AHL25(3)
           --------->AHL25(1)                             ==========================================
           <---------AHL20(2)                             --------------->AGL15
           --------->AHL12(3)                            <-----------------AGL1
           --------->AHL12(1)                            <-----------------AGL2
           <---------AHL12(1)                            <---------ANAC58
           --------->AHL20(2)                         <----------DOF2
           <---------AHL12(3)                        <---------DOF5.7(1)
          --------->AHL25(3)                       ------>ZmHOX2a(2)
       --------->AHL20(2)                         --------->GLK1(1)
       --------->AHL12(3)                         <------ZmHOX2a(2)
<----------DOF2                                  <---------AGP1
xxsmallRNA(se3)                                  --------->GATA12
xxxxxxxxxxxsmallRNA(i)                           --------->ARR14(2)
xxxxxxxxxxxxxxx>smallRNA(si3)                    <---------ARR11(3)
xxxxxxxxxsmallRNA(s)                             <---------ARR14(3)
xxxxxxxx>smallRNA(se3)                           --------->ARR14(3)
xxxxxxxxxxxxxxsmallRNA(si3)                      --------->ARR11(3)                <---------YAB5
xxxxxxxsmallRNA(s)                               <---------GATA12              --------->ANAC55(2)
xxxxxxxsmallRNA(i)                               --------->RVE1(2)             --------->ANAC58
xxxxxxsmallRNA(s)                        --------->KAN1  <---------ANAC58      --------->ANAC58
xxxx>smallRNA(i)  --------->ANAC46       <---------AHL12(1)   --------->CCA1(2)<---------ANAC55(2)
xx>smallRNA(s)  <-----------GT1          --------->AHL12(1)  <---------RVE1(2) --------->ANAC46
xxxxxxxx>smallRNA(fl3)            <----------ID1 <---------ARR14(2)         <---------RVE1(2)
xxxxxxxxxxsmallRNA(s)           <---------AHL12(2)<---------GLK1(1)    <---------WOX13(2)   --------
 
caactttcatatatataatttacgaaaaaaaaaaaaaaaaacaaatattcaagatctctttcttgatatgggccaatttgatacgaaacattttccagcc  1281600
                                                 <--------P <---------TOE2(3)               <-------
                                               --------->ALFIN1                           <---------ANAC58
                  <---------LBD16            <---------ANAC58                             <---------ANAC58
             <---------DAG2                  <---------ANAC58                           <---------ANAC58
             --------------->AGL15           <---------ANAC46                           <---------ANAC46
             <----------DOF2                <---------TOE2(3)                           <---------ANAC58
     <---------ANAC58                       <---------TOE1(3)            --------->WOX13(2) <-------
     <---------ANAC58                      <---------DOF5.7(2)           <---------WOX13(2) --------
 <---------DAG2  <-----------GT1   --------->ATHB51         --------->DOF5.7(1)         <------MYB46(1)
 <---------DOF5.7(1)              --------->ICU4--------->REM1(2)    <-----------GT1    <------MYB83
=============================MADS_MADS   --------->DOF5.7(2)--------->DAG2   <------MYB83 <---------ANAC46
->ANAC46  <-----------GT1      ----------------->AGL1     <---------ATHB12   <------MYB46(1)<-------
 
ataacctttcgttttactttatacgggctataggcccattatgggttaacgtgtaggcccaataaggtgttttttcaatttggtttgcatttggtgtgtg  1281700
                                      --------->RVE1(2)
                                     --------->WOX13(1)
                                 ----------->GT1
                                ------->MYC3
                                <-------MYC2
                                <-------MYC3
                                ------->MYC2
                               <---------ANAC58        <---------TOE1(2)
       <---------ZAT2          <------NtERF2          ------>ZmHOX2a(1)
       <---------At4g35610     <---------ANAC58      --------->TOE1(2)                       -------
       --------->At4g35610     <---------ANAC46      --------->TOE2(2)                  ------------
   <-----------HVH21          ------>NtERF2     --------->KAN1                      --------->ANAC46
--ANAC58                     <---------ANAC58   <---------KAN1               --------->HSFB2a(2)
--ANAC58                     <---------ANAC46  <---------RVE1(2)             <---------HSFB2a(2)   <
->ALFIN1                  --------->ALFIN1--------->MYB52(1)             <---------ANAC58    -------
--ANAC46   --------->REM1(1) <---------ANAC58----------->GT1             <---------ANAC58  ---------
 
tgtgtgtgtcagctacaatttctcaaggagaggcgcgtgtaaatcaaacggataatcctacggttttgatgaaatggcttctcgtagacctcacaatctc  1281800
                            <---------HSFB2a(2)
 --------->ARR11(3)         --------->HSFB2a(2)                      ----------->GT1
 <---------ARR11(3)         <---------HSFC1(1)               <----------DOF2<---------TOE2(3)
-->YAB5              <---------DOF5.7(1)              ------>ZmHOX2a(1)     <---------TOE1(3)
>CBF             --------->ANAC46      <---------DOF5.7(1)  --------->TOE1(3)        <----------DOF2
---------YAB5  <-----------GT1       *TSS   <---------MYB59 --------->TOE2(3)       <---------DOF5.7(1)
-->RVE1(2) <----------DOF2  --------->HSFC1(1)       --------->TOE1(3)      --------->MYB59
>RVE1(2)  <---------DOF5.7(1)   <-----------GT1      --------->TOE2(3)  <----------DOF2       ------
 
taaacatctcttctctttatacgctcttcttctagaaacctctcttacctcactctccttaaacctttaatagggtttttaggttactctttgttcaact  1281900
                                                  <----------DOF2
                                               --------->GATA12
                                               <-----------ARR10
                                               <---------ARR11(1)
                                          --------->TOE2(3)
                                        --------->ARR11(3)
                                        <---------ARR11(3)
                                        --------->RVE1(2)
                                       --------->CCA1(1)
                                       --------->RVE1(1)
                                      <---------AHL12(1)
                                      <---------AHL25(3)
                   <---------RVE1(2)  --------->AHL12(1)
                   <---------YAB5    --------->AHL20(3)
              <----------DOF2        <---------AHL20(3)
             <---------DOF5.7(1)     <---------AHL25(1)                            ------>ZmHOX2a(1)
            <---------------AGL15    --------->AHL20(2)               <---------GATA12
       <----------DOF2         ----------->GT1 --------->ARR11(3)     --------->GATA12<----------DOF2
      <---------DOF5.7(1)  <---------RVE1(2)  <---------CCA1(2)       --------->RVE1(2)
--->MYB46(3)--------------->AGL15    --------->AHL12(3)         <----------DOF2  <---------At4g35610
 
actacaaactcttttctctttagagattgagagattgtaaaaaaatctcaaatcttttccttcacaactttcaaatctaatggctcctgctttgagtaga  1282000
                                                                                           <--------
                                                                                           <--------
                                                                                       --------->RAP2.3(1)
                                                                                       --------->DEAR4(2)
                                                                                       <------NtERF2
                                                                                       --------->ATERF1(1)
                                                                                      <---------ORA47(2)
                                                                                      <---------DEAR4(2)
                                                                                      ------>NtERF2
                                                                                      <---------RAP2.3(1)
                                                                                      <---------ERF1
                                                                                      <---------RRTF1(1)
                                                                                      <---------ATERF1(1)
                                                                                      <---------RAP2.6(1)
                                                                                     --------->DEAR3(1)
                                                                                     <---------RAP2.3(2)
                                                                                     <---------RAP2.3(3)
                                                                                     <---------RRTF1(3)
                                                                                     <---------DEAR3(1)
                                                                                     <---------RRTF1(2)
                                                                                    <---------ABI4(1)
                                                                                   <---------ATERF1(1)
                                                                                  --------->ANAC58
                                                                                  --------->O2
                                                                                  ==================
                                                                                  ==================
                                                                                  <---------TGA1a
               --------->WRKY12        <---------CCA1(2)                          --------->ANAC58
             <----------DOF2         ------>ZmHOX2a(1)           --------->GLK1(2)--------->ANAC46 -
       <---------GATA12        --------->YAB5             <---------At4g35610     --------->TGA1a --
      --------->ANAC46        <---------ATHB12            ----------->RAV1(2)   <---------ALFIN1 <--
    <---------ALFIN1        --------->WOX13(1)   <---------CCA1(2)     <---------CCA1(2) ------>NtERF2
   <---------REM1(2)<---------ZAT14----------->RAV1(2)    --------->At4g35610 <---------ALFIN1   ---
 
agtctctacacatctcctttgacttcagttccaatcactcctgtctcttctcgtctctctcatctgagaagctcgtttctcccacacggcggcgctttaa  1282100
                                                                       <---------ANAC58
                                                                       <---------ANAC58
                                                                      <---------LBD16
                                                                    --------->ALFIN1
                                                                  --------->O2
                                                                  <---------ANAC46
                                                                  --------->DEAR3(1)
                                                                  =====================bZIP_DOF
                                                                 --------->ATERF1(1)
                                                                 <------NtERF2
                                                               --------->RAP2.3(2)
                                                               --------->RRTF1(3)
                                                               --------->RAP2.3(3)
                                                               --------->DEAR3(1)
                                                               <---------DEAR3(1)
                                                              --------->RAP2.3(1)
                                                              --------->ORA47(2)
                                                              --------->ERF1
                                                              --------->DEAR4(2)
                                                              --------->RAP2.6(1)
                                                              --------->RRTF1(1)
                                                              <------NtERF2
                                                              --------->ATERF1(1)
                                                             <---------ATERF1(1)
                                                             <---------RAP2.3(1)
                                                             <---------RRTF1(1)
                                                         ----------->TGA1
              --------->At4g35610                  <---------ZAT14--------->TGA1a
              --------->ZAT2                       --------->REM1(2)----------->HVH21
              <---------ZAT2                      ----------->HVH21<-----------HVH21
        <---------ANAC46                          <---------MYB52(1)<---------DEAR3(1)
        <---------ANAC55(1)                      --------->LBD16--------->ABI4(1)
    <----------DOF2                       <---------ARR11(2) ------>NtERF2  ---------->DOF2
   <---------ANAC58                       <---------ARR14(2)--------->bZIP60(1)
   <---------ANAC58                       --------->ARR11(2)<---------O2--------->LBD16
 --------->LBD16                     --------->ARR11(2)  ----------->HVH21  ========================
--------->DEAR3(1)                   <-----------GT1    <-----------HVH21<------NtERF2
--DOF2  <---------ANAC58     --------->DOF5.7(1)<---------ANAC46------>NtERF2
-DAG2   <---------ANAC58   ---------->DOF2--------->ARR14(2)<---------bZIP60(2)
==bZIP_DOF    <---------At4g35610 <---------REM1(1)--------->ZAT14<---------O2--------->DOF5.7(1)
==bZIP_DOF<---------REM1(1)=================================================bZIP_DOF            <---
-------->DEAR3(2)      <---------HSFB2a(2)<---------GLK1(2) <---------bZIP60(1)              -------
------->MYB52(1)     <---------KAN1  <---------ARR11(2)--------->ALFIN1<---------ANAC46 --------->ZAT14
-------ARR14(2)    <---------GLK1(2)----------->HVH21<---------ANAC46 <------NtERF2<---------ZAT14
------>ARR14(2)<---------ANAC46  <---------GATA12<-----------HVH21<---------TGA1a  --------->ZAT18<-
 
gaaccggcgtttcgtgtagctggaatctcgaaaagagatgtaaccgattcgccgtgaagtgtgacgccgccgtggcggagaaagagaccactgaagaagg  1282200
                              <------MYB46(1)
                              <------MYB83
                            --------->ALFIN1
                          <---------ZAT2
                          --------->ZAT2
                          ======================bZIP_DOF
                          <---------O2
--------->TGA1a           <---------TGA1a
<---------ANAC55(2)       <---------ANAC46
--------->ZAT2            <---------bZIP60(2)
<---------TGA1a          <---------AtMYB61 --------->RVE1(2)
<---------O2         <---------ZAT2        <---------ARR11(3)
--------->O2 <---------ANAC58 <---------DEAR3(2)  ---------->DOF2
<---------ZAT2       --------->At4g35610   --------->ARR14(2)
================================================bZIP_DOF
--------->At4g35610  --------->ZAT2        <---------ARR14(2)                                     --
<---------At4g35610  <---------At4g35610   --------->ARR11(3)                                  -----
==========bZIP_DOF  ------>MYB46(1)       <---------CCA1(2)                <---------ARR14(2)  <----
--------HVH21<---------ANAC58<---------MYB46(3)  ------>ZmHOX2a(1)        <---------CCA1(2)   <-----
-->DOF5.7(1)<---------------AtSPL8      --------->YAB1                    <---------GLK1(1) --------
----------RAV1(2)   ------>MYB83     <----------DOF2                 <---------LBD16   --------->ATHB12
 
gtcaggtgagaagtttgagtaccaagctgaggtgggttctctttcatatctcctaaagtttcaatcttgttttctgggtatctctcaacttgatggggat  1282300
<- Previous    Next ->

AGI:  At2g04030.1   
Description:  CR88 (EMBRYO DEFECTIVE 1956); ATP binding. similar to ATP binding [Arabidopsis thaliana] (TAIR:AT3G07770.1); similar to hypothetical protein OsI_030703 [Oryza sativa (indica cultivar-group)] (GB:EAZ09471.1); similar to hypothetical protein OsI_028659 [Oryza sativa (indica cultivar-group)] (GB:EAZ07427.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15342.1); contains InterPro domain ATP-binding region, ATPase-like; (InterPro:IPR003594); contains InterPro domain Heat shock protein Hsp90; (InterPro:IPR001404)
Range:  from: 1281838    to: 1286101    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version