AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                 <--
                                                                                                ----
                                                    <---------WRKY12      <---------YAB1        ----
                     <---------ZAT14                <---------WRKY38(1)   <---------YAB5        ----
                     --------->ZAT14                <---------WRKY45   <---------YAB1           ----
                     --------->ZAT18               <<<<<<<<<WRKY6  <---------ANAC46             ----
                     <---------ZAT18             --------->YAB1  --------->LBD16                <---
              ------>ZmHOX2a(1)              --------->YAB5      ------>NtERF2             ---------
        <---------ALFIN1                   --------->RVE1(2)   <---------LBD16             ---------
       --------->ZAT18                 --------->YAB1<---------DOF5.7(2)--------->YAB1     ---------
       <---------ZAT18                <---------ATHB12        <---------ATERF1(1)  -----------------
       <---------WRKY38(1)           --------->RVE1(2)  ------->MYC3  <---------AHL20(3)  --------->ZAT18
--------->RAV1(1) <---------ZAT6    --------->WOX13(1)  <-------MYC3  --------->AHL20(3)  ------->TEIL
 
gccacattggtccactccttagagtgaacaccagtcttccaatcaaaatcaatagtcaacgtggtctccggcttataatcaatggcagtgatgcacgcta  893200
-------MYB59
----->ANAC55(2)
----->ANAC55(1)
----->ANAC46                                                                                     ---
----->ANAC58                                                                               ---------
----->ANAC58                                                   <---------GLK1(2)         ------>MYB46(1)
------ANAC55(2)                                               --------->KAN1             ------>MYB83
>ANAC46                                                   --------->AtLEC2       <---------bZIP60(1)
>ANAC58    --------->YAB1            ------>MYB83       <---------ANAC46         --------->bZIP60(1)
>ANAC58   <---------YAB1             ------>MYB46(1)    <---------ANAC58        <------NtERF2   ----
------>TaNAC69(2)              ----------->HVH21        <---------ANAC58   <---------AtMYB61  ------
 
cgtaactcccattttcataagcagtaaacgagaactgaccagcctctacattatcggcttcgtgcaaattcttcccttgtggtggcatcacctacaataa  893300
                                                                                                  --
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                              <-----
                                                                                            --------
                                     <---------RVE1(2)               =====================HOX2a_HOX2a
                                     --------->GATA12                ------>ZmHOX2a(2)      --------
                                   ----------->ARR10                 ===========================HOX2a_HOX2a
                          --------->WOX13(1)                       <---------ARR11(3)    ===========
   <---------ARR11(3)  --------->RVE1(2)                           --------->ARR11(3)    <------ZmHOX2a(1)
---->GAMYB             --------->ARR11(3)                      --------->YAB5      <------ZmHOX2a(1)
>YAB1                  --------->GLK1(2)                 --------->TOE1(3)         =================
----->MYB46(3)         <---------ARR11(3)        --------->GATA12  <---------RVE1(2) --------->DOF5.7(1)
--->YAB1    --------->AHL20(2) <---------ANAC55(2)       --------->TOE2(3)    --------->GLK1(2) <---
 
ccacaagataacacattaaaaacaaaaatctatcaagtgagatttgtgatgaaatctataccttgacgatgatcttgtgagaatcaggaagaggatgatg  893400
                                                   --------->GATA12
                                                   <---------GATA12
                                                   <-----------ARR10
                                                   <---------ARR14(2)
                                                   --------->ARR14(2)
                                                  <---------CCA1(2)
   <---------MYB52(1)                         <---------ANAC58
---->ZmHOX2a(2)                               <---------ANAC58
----->ARR11(3)                                <---------ANAC46
--------ARR10                              <---------ARR11(2)                                   ----
------ARR11(3)                             --------->ARR11(2)                              ---------
----YAB1  <---------ARR11(2)               <---------ARR14(2)                              <--------
->YAB5<---------TOE1(3)                  <----------DOF2               <---------ANAC58    ---------
->YAB1<---------TOE2(3)                 <---------ANAC46               <---------ANAC58    ---------
=====HOX2a_HOX2a                        <---------ANAC58           ------->TEIL      --------->DOF5.7(2)
=====HOX2a_HOX2a                  <---------RVE1(2)------->TEIL  <-------TEIL       <----------DOF2
------RVE1(2)            <-----------GT1<---------ANAC58 ------>ZmHOX2a(1)  <---------HSFB2a(2) ----
 
atcttcgttagggtttacgatgaagtatttaccaatagacatggcgttttcgtgaatctcctcaccgatgcatttcgttttcgaagactttaactcgtaa  893500
                                                                          --------->At4g35610
                                                                       --------->ATERF1(1)
                                                                       <------NtERF2
                                                                       ----------->HVH21
                                                                      <-----------TGA1
                                                                      <-----------HVH21
                                                                     <---------TGA2(1)
                                                                     <---------ANAC46
                                                                     <---------ANAC58
                                                                     <---------bZIP60(1)
                                                                     --------->bZIP60(1)
                                                                     <---------ANAC58
                                                              <------ZmHOX2a(2)
                                                              --------->CCA1(2)
                                                             --------->ARR11(2)
                                      --------->ANAC58       --------->ARR11(3)
                                      --------->ANAC58       <---------ARR11(2)
                                    ---------->DOF2          <---------ARR14(2)
                              --------->ICU4                 <---------ARR11(3)
   <---------RVE1(2)     --------->ANAC58                    --------->ARR14(2)
  --------->YAB1         --------->ANAC46                    --------->GATA12
----->ANAC58--------->HSFB2a(2)--------->YAB1                --------->RVE1(2)
>ANAC46 --------->ZAT18  --------->ANAC58                    <---------GATA12    --------->DOF5.7(1)
-ANAC55(2)  <---------HSFB2a(2)--------->YAB5               <---------KAN1<---------LBD16
>ANAC55(2) <---------LBD16    <---------YAB5                --------->GLK1(1)  ---------->DOF2   ---
>ANAC55(1)<---------ANAC46------->GAMYB          --------->ZAT2      --------->TGA2(1)--------->DOF5.7(1)
----->ANAC58------>ZmHOX2a(1) <---------ATHB12   <---------ZAT2<-------TEIL --------->LBD16     ----
 
cgcattgatagtgtcctgggagataacaacgcaatgatcaaaagcaaaatcgagcttcgacgaagatccatggcgtcaccggaaaagagaagagagagag  893600
                                                                                     <---------AHL25(3)
                                                                                     <---------AHL20(3)
                                                                                     --------->AHL20(3)
                                                                                     --------->AHL25(1)
                                                                                     <---------AHL20(2)
                                                                                     --------->AHL20(1)
                                                                                     <---------AHL25(1)
                                                                                     <---------AHL25(2)
                                                                                   --------->AHL12(2)
                                                                                   <---------AHL12(2)
                                                                                  --------->AHL20(3)
                                                                                  <---------AHL25(3)
                                                                                  <---------AHL12(2)
                                                                                  --------->AHL20(1)
                                                                                  <---------AHL25(2)
                                                                                  <---------AHL12(3)
                                                                                  <---------AHL20(3)
                                                                                 --------->AHL25(3)
                                                                                 <---------AHL12(3)
                                                                                 --------->AHL25(1)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL12(1)
                                                                                 <---------AHL25(3)
                                                                                 <---------AHL20(2)
                                                                                 <---------AHL25(2)
                                                                                 --------->AHL12(3)
                                                                                 --------->ATHB51
                                                                                 <---------ICU4
                                                                                 <---------AHL12(1)
                                                                                <---------YAB5
                                                                                --------->AHL25(3)
                                        ===========================================MYC_MYB
                                        <--------P                              <---------YAB1
                                        <---------KAN1                         --------->WOX13(2)
                                    <---------ANAC58                      ------->MYC2
                                    <---------ANAC46                      <-------MYC4
                                    <---------ANAC58                      <-------MYC3
                                  --------->ARR11(2)                      <-------MYC2
                                  <---------ARR11(2)                      ------->MYC4
                                 <---------ARR11(2)                       ------->MYC3--------->ATHB12
                                 <---------ARR14(2)                      --------->O2<---------AHL20(1)
                                 <---------MYB52(1)                      <---------ANAC55(2)
                                <---------RAP2.6(3)                      --------->TGA1a
                               <---------------AGL15                     <---------O2--------->AHL20(2)
                               <---------ANAC58  --------->DOF5.7(1)     <---------TGA1a
                               <---------ANAC58====================================bZIP_DOF
                              ----------------->AGL1             ==================bZIP_DOF
   <---------ARR11(3)         <-----------------AGL1             <----------DOF2--------->ICU4
   --------->ARR11(3)         ----------------->AG               ==================bZIP_DOF
--------->AHL20(2)          <-----------GT1    ---------->DOF2  --------->MYB52(2)--------->AHL25(2)
-------->GT1   ------------>CBF--------------->AGL15   ---------->DOF2 <---------ALFIN1<------------CBF
------->GT1    <---------YAB5 <-----------------AGL2   ============================bZIP_DOF     ----
 
agataaaatcttgcagtagtcaatgttttttttgccgtttcgggtaagacaaaagagtcaaagacgttctttgcacacgtgtaattattttattggtgaa  893700
      <XXXXXXXXXXXXXXXXXXXXMIR399A
      <XXXXXXXXXXXXXXXXXXXXMIR399D
      <XXXXXXXXXXXXXXXXXXXXMIR399F
 ------->MYC3
 <-------MYC2
 ------->MYC2
 <-------MYC3
==========================bZIP_DOF
--------->ANAC55(2)
<---------ANAC55(2)
--------->ANAC46
--------->ANAC58
==========================bZIP_DOF
--------->bZIP60(2)
--------->O2
<---------O2
--------->TGA1a                                  --------->ARR11(2)            <---------O2
<---------TGA1a<----------DOF2                   <---------ARR11(2)       <----------DOF2
--------->ANAC58                           <---------RVE1(2)            ------->TEIL ------------>CBF
------------->PIF3(1) --------->ICU4  <----------DOF2               --------->WOX13(2)             <
 
gacacgtgagcaagtcttctttgtcatgagcatagtatgggctttgtatatggaactgggcttagttttgtaatgaactttcacttggcacaatatttgg  893800
                          --------->AHL12(2)
                        --------->AHL12(3)                                             --------->AHL25(1)
                        <---------AHL20(2)                                             --------->AHL25(2)
                        --------->AHL20(2)                                             <---------AHL12(3)
                        --------->AHL25(3)                                             --------->AHL12(3)
                        <---------AHL12(3)                                             <---------AHL20(2)
                        <---------AHL25(3)                                             <---------AHL25(1)
                        <---------AHL25(1)                                             <---------AHL25(2)
                        --------->AHL25(1)                                             <---------AHL25(3)
                  --------->LBD16                                                     --------->AHL25(1)
                 --------->ANAC46                                        --------->ARR11(2)
              --------->ARR14(2)                                         <---------ARR11(2)
              <---------ARR14(2)                                         --------->GATA12        ---
              --------->ARR11(2)                 xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3) <---------AHL12(3)
             --------->KAN1                      <-------TEIL --------->GLK1(1)       --------->AHL12(2)
            <---------AHL20(1)               xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)     <---------AHL25(1)
            --------->ARR11(3)              xxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)        --------->AHL12(1)
            <---------ARR11(3)           <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)         <---------AHL12(1)
          <---------AHL12(2)         <-----------GT1         --------->GATA12         --------->AHL25(3)
          --------->AHL12(2)        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)<---------ARR14(2) <-------
         --------->AHL20(2)        <---------AHL12(1)        <---------GATA12        <---------KAN1<
         <---------AHL12(3)        --------->AHL12(1) <---------KAN1     --------->ARR14(2)<--------
         --------->AHL20(3)       --------->WOX13(2)  --------->KAN1--------->RVE1(2)<---------AHL12(1)
         --------->AHL25(1)      --------->AHL12(2)--------->LBD16  --------->ARR11(2)--------->AHL25(2)
         <---------AHL20(3)    --------->AHL20(2)<---------LBD16    <---------ARR11(2)<---------AHL25(2)
-----------TBP<---------ARR11(2)<---------AHL20(2)<---------HSFB2a(2)    <---------GATA12  ---------
 
gcttatatagattaatatatccgaaatttaaattttaaattttcaatataggtccggacattcagatttcatatcggattcagttcgaattttttttatt  893900
                                                                            --------->GLK1(1)
                                                                            <---------KAN1
                                                                           <---------RVE1(2)
                                                                           --------->ARR11(2)
                         --------->ZAT6                                    --------->ARR14(2)
                        <---------TOE2(3)                                  --------->GATA12
                        <---------YAB1                                     <---------GATA12
                    <---------WOX13(2)                                     <---------ARR14(2)
 --------->KAN1     <---------AHL12(2)              <------MYB83           <---------ARR11(2)
 --------->YAB5     --------->WOX13(2)              <------MYB46(1)     --------->ETT(1)
-------->GT1   ----------->GT1    <---------KAN1   <---------AtMYB61    <---------ANAC46
--AHL20(2)    --------->DAG2   <------ZmHOX2a(1)   --------->MYB59     <------NtERF2
---------RVE1(2)    --------->AHL12(2)     <---------ARR14(2)      <------MYB83
-AHL20(2)    ---------->DOF2  <---------YAB1     <---------MYB52(1)<------MYB46(1)
>AHL25(3)<---------KAN1<-----------GT1 --------->YAB5             <---------AtMYB61          <------
 
tggataattcggatgaaaaagtttattaacattaggattatatgactattcggtttggtttcacttcggatggtgtcggatttgtatgggtttcaaatca  894000
                                --------->AHL25(2)
                                <---------AHL20(2)
                                --------->AHL20(2)
                                --------->AHL12(3)
                                <---------AHL20(3)
                                --------->AHL20(3)
                                --------->AHL25(1)
                                <---------AHL25(1)               ----------->GT1
                   <---------AHL25(3)                            <------MYB83        ----------->GT1
                   <---------AHL25(2)             --------->WOX13(2)          <---------------AGL15
                   <---------AHL20(2)             <---------WOX13(2)   --------->WOX13(2)      <----
                   --------->AHL12(1)            --------->AHL12(2)    <---------WOX13(2)    -------
                   --------->AHL25(2)           --------->AHL25(3)    --------->AHL12(2)   ---------
                   <---------AHL12(1)           <---------AHL20(2)   <---------AHL25(1)    <--------
                   --------->AHL20(2)           --------->AHL25(1)   --------->AHL25(1)    <--------
                   <---------AHL25(1)       ----------->GT1      <------MYB46(1)   ---------->DOF2
                   <---------AHL20(3)--------->YAB1   <-----------GT1--------->AHL25(3)    ---------
---ATHB12<---------AHL12(2)    --------->YAB1   --------->AHL20(2)   <---------AHL20(2)   --------->AHL12(2)
 
gtttttgagaaaaaaaaactaaaaaattgttcaattttaatcaaaaatcgtttaattttactaaaatttggtttaattttgcaaaacaaagtaaaattat  894100
<- Previous    Next ->

AGI:  At2g03040.1   
Description:  transmembrane protein-related. similar to protein transmembrane transporter [Arabidopsis thaliana] (TAIR:AT2G03290.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO15017.1); contains InterPro domain emp24/gp25L/p24; (InterPro:IPR000348); contains InterPro domain GOLD (InterPro:IPR009038)
Range:  from: 892822    to: 893571    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version