AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                  --------->ANAC46                          --------->DAG2
                  --------->TOE2(3)                                        ---------->DOF2
                  --------->TOE1(3)                                    <---------ZAT6
     <---------At4g35610         <---------At5g28300         --------->TOE2(3)               -------
 
aaaatttgagttgattcaaaactttaaacttacattcacagcattgctctgaaaaacaaaaaaaacttaaactagagataaagcttcaaaactaagtgat  672800
                                                               ---------->DOF2
                                                             <---------AHL12(2)               <-----
                            --------->GATA12                --------->YAB1                    <-----
                            <---------GATA12                --------->YAB5                    <-----
                            <---------ARR14(2)             <---------ATHB51     <---------At4g35610
                       --------->RVE1(2)            <---------WOX13(1)   <----------DOF2 <----------
             --------->ZAT6 --------->RVE1(2)      --------->WOX13(2)   <---------DOF5.7(1)  <------
-->YAB5  <---------MYB52(2) --------->ARR14(2)    --------->ATHB12   <---------CCA1(2)--------->WOX13(2)
 
tccaagttttgaactaacacttacattatcaaatccagtcgatgaagaacacttgattgacaataataaagcatctcttttgtagcttctattaaccctt  672900
                                                             ------>MYB46(1)
                                                             <---------ARR11(2)
                                                             ------>MYB83
                                                             --------->ARR11(2)
                                                       ------>ZmHOX2a(1)
                                                 <-----------ARR10
                                                 --------->ARR11(3)     --------->ATHB12
                                                 <---------ARR11(3)    <---------YAB5
                                            --------->YAB1 <---------MYB46(2)                -------
----DOF5.7(1)                              <<<<<<<<<ARR2  --------->ANAC46  <---------MYB46(3)
-----DOF2                                --------->WOX13(1)<---------MYB52(2)              ---------
----DAG2                     <---------YAB5<---------ATHB12--------->DEAR3(1)             <---------AHL20(2)
-GT1--------->RVE1(2)    --------->RVE1(2)--------->RVE1(2)--------->MYB46(3)          ------->TEIL
---DOF5.7(1)       ----------->GT1--------->YAB1 --------->RVE1(2)     <-------TEIL------->TEIL  <--
 
ttcgaaaaatccagtttttgaactgaaaaatcaacattcagaaacaatcaaaaatctcctcaccgaaccagagattcattggtttgaacgtatataaaga  673000
                                                                                                  <-
                                              --------->WOX13(2)               <------NtERF2      --
          <---------ANAC58          --------->CCA1(2)                        <---------ANAC46     <-
-->DOF5.7(1)                  ----------->RAV1(1)        <---------TOE1(3)   --------->ETT(1)     --
->DOF2    <---------ANAC58   --------->MYB46(3)      <----------DOF2       <-----------HVH21     ---
-------KAN1            --------->At4g35610    <---------WOX13(2)          <-----------RAV1(1)   ----
 
gtatgagaaattgccttgagaacgatagctaaaccacagataagagttcaatttgactttaagcttcggacacagaaatgtcggagaagtaatgaagcca  673100
                                                                          <-----------TBP
                                                                          --------->AHL20(2)
                                                                          <---------AHL20(2)
                                                                          --------->AHL12(3)
                                                          <---------LBD16 <---------AHL12(3)
                                                          <---------HSFB2a(2)
     ----------->HVH21                                <---------ARR14(2)--------->AHL20(2)
   ----------->RAV1(2)                                --------->ARR14(2)----------->TBP
<-------TEIL                                          --------->ARR11(2)<---------AHL12(3)
--------ARR14(2)                                     *TSS ------>ZmHOX2a(1) ----------->TBP
------->ARR14(2)                                     <---------MYB52(1)<---------ARR11(3)
--------GLK1(2)                                     --------->LBD16    <---------AHL20(1)
------->ARR11(1)                            ---------->DOF2            --------->AHL20(1)        ---
------>KAN1                   ----------->RAV1(2) <---------LBD16 ------------>CBF    <---------WOX13(2)
------->ARR10           <-----------GT1  >>>>>>>>>TBF1<---------ARR11(2)--------->AHL12(3)   -------
 
agattcgtctgaagcatcgccatgttttatctcgcctgagagaagaagaaagctccggttcctcggagaaccaatatatatataaggccaactaaaaaca  673200
                                                           ------------>CBF
                                                --------->DOF5.7(1)
                                               <---------ICU4
                              --------->YAB1 <---------WOX13(2)                                 ----
                             --------->ZAT6  --------->WOX13(2)    --------->At5g28300    --------->DOF5.7(1)
    <-----------HVH21      --------->YAB1   --------->YAB1 --------->AHL20(2)           ---------->DOF2
------->DOF2   --------->AHL20(2)         --------->AHL20(2)      ----------->GT1 ---------->DOF2
----->CBF    <---------WOX13(2)         <----------DOF2<---------ATHB12   ----------->RAV1(1) ------
 
ataagcccatcaggcccattaaaaactcagtaatactaatgggcttttaataaggcccataattcaatacagtaaaacaacacaacaaagctaaagagaa  673300
                                                                                            --------
                                                        ----------->GT1                    <--------
                                                        --------->LBD16                    <--------
                                                     --------->MYB52(1)                    ---------
                                                     -------->P      --------->LBD16       <--------
                                                   --------->MYB46(3)------>NtERF2         ---------
      --------->TOE2(3)                --------->ARR11(2)           <---------LBD16       --------->ANAC58
     ----------->GT1                   --------->ARR14(2)     <---------AHL12(1)        <------ZmHOX2a(1)
     <---------ANAC55(2) --------->LBD16           <---------KAN1<-----------GT1 <---------ANAC46
   *TSS                  ----------->GT1          <---------KAN4(2)<---------LBD16 --------->ALFIN1
  --------->DOF5.7(1)  <---------LBD16 <---------ARR14(2)    --------->AHL12(2)<---------KAN1
------->GT1           --------->MYB52(1)    <---------MYB52(1)--------->AHL12(1)--------->ATHB12
---->DOF2   --------->RVE1(2)          <---------ARR11(2)--------->At5g28300 >>>>>>>>>NAM --------->ANAC58
 
agaaaaaaacgtaaaaatcgaagaagaccggagaaaatggcgaaaccgttgggaacaaccggtgaatttttccggcgaagggatgagtggaggaagcatc  673400
                                                                                    ================
                                                                                    ------>ZmHOX2a(2)
                                                                                   <------ZmHOX2a(2)
                                                                                   =================
                                                 <------MYB83                     <---------AGP1
                                                 <------MYB46(1)                  --------->AGP1
                                                 <---------MYB46(3)               <---------ARR11(2)
                                               <--------P                         --------->RVE1(2)
                                             <-----------RAV1(1)                  <---------ARR14(2)
                                         <---------YAB5                           --------->ARR14(2)
                                  --------->MYB52(1)                              --------->ARR11(2)
                                  --------->ARR11(2)                              --------->ARR11(3)
                                  <---------ARR11(2)------>NtERF2                 <---------GATA12
                              --------->LBD16--------->ALFIN1               <---------ZAT14
                        ------->TEIL   <---------ARR11(2)                <---------DEAR3(2)
->KAN1                 <---------ALFIN1<---------ARR14(2)               <---------At1g77200
-HSFB2a(1)           --------->ANAC46  --------->ARR14(2)               <---------DEAR3(1)
-YAB5   --------->RVE1(2)    --------->HSFB2a(2)<---------AtMYB61     <-----------HVH21
>HSFC1(2)            --------->ANAC55(2)--------->GLK1(2)      --------->WRKY12   --------->GATA12
-HSFC1(2)            --------->ANAC58  <---------GLK1(2)       <---------ARR11(2) <---------ARR11(3)
>HSFB2a(1)           --------->ANAC58  --------->ARR11(2)   <---------ANAC46--------->ZAT14
 
cgatgctatcgaatcaaatgagacacgcacttccaggtatcggaatcggtgttggtgccttctgcgtttacctcgtcggtgaacagatctatagcaaact  673500
                                                                               --------->ARR11(3)
                                                                               --------->GATA12
                                                                               <---------ARR11(3)
                                                                       <---------AHL20(3)
                                                                     --------->AHL20(2)
                                                                   <---------WOX13(2)--------->HSFC1(1)
                                                              <------MYB46(1)  <---------GATA12
                                                              ----------->GT1  <---------ARR14(2)
                                                              <---------ANAC55(2)    <---------HSFB2a(2)
                                                              <------MYB83     <-----------ARR10
                                                         <---------ICU4--------->AHL20(3)
                <---------ICU4                           -------->ATHB1<---------AHL12(3)
                --------->YAB1                           --------->YAB5<---------AHL12(2)
               <---------YAB5           <---------ALFIN1 <--------HAHB4--------->AHL12(3)
               <---------ATHB12     --------->At4g35610  --------->ATHB12      --------->ARR14(2)
             --------->WOX13(1)    --------->ANAC46      --------->YAB1<---------AHL25(1)
     ------>ZmHOX2a(1)            ------->GAMYB         <---------YAB5--------->YAB1 --------->HSFB2a(2)
   <---------DOF5.7(1)          -------->P              --------->ICU4<---------AHL25(3)  <---------KAN1
============HOX2a_HOX2a       --------->MYB46(3)       --------->GLK1(2)  --------->RVE1(2)        <
============HOX2a_HOX2a--------->At4g35610<---------At4g35610--------->MYB59  <---------CCA1(2)    <
 
catggctccttcttctcaatcatcgcatcagaaacaacccgctccatctcactgagagaatcattaggtaaaataaaaatcaaatcttctcgaatttgtt  673600
              <---------CCA1(2)
              --------->KAN1                                                           <---------O2
        ----------->GT1                                                                --------->TGA1a
       <---------TOE2(2)                                                               <---------TGA1a
       <---------TOE1(2)                                                               --------->O2
   --------->HSFB2a(2)                                                             <-----------HVH21
   <---------LBD16                <---------ZAT14                                 <---------KAN1
   <---------HSFB2a(2)        <-----------GT1                            --------->ARR11(3)    <----
<----------DOF2           <---------GATA12       ----------->GT1         <---------ARR11(3)  <------
---------ANAC58    ------>ZmHOX2a(1)         --------->ATHB12        ---------->DOF2   <---------ANAC55(2)
---------ANAC58   --------->TOE2(3)     ----------->HVH21            ============================bZIP_DOF
 
ttgcttctcggaggtttatatcctaaatcgatttgacttctctgtgaaagattggataaacaaaaactttggcaaagttcttagaatgtcacgtttgagg  673700
<- Previous    Next ->

AGI:  At2g02500.1   
Description:  ISPD (2-C-METHYL-D-ERYTHRITOL 4-PHOSPHATE CYTIDYLTRANSFERASE). Identical to 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplast precursor (ISPD) [Arabidopsis Thaliana] (GB:P69834;GB:O64726;GB:Q9LL91); similar to 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase [Hevea brasiliensis] (GB:BAF98292.1); contains InterPro domain 4-diphosphocytidyl-2C-methyl-D-erythritol synthase; (InterPro:IPR001228)
Range:  from: 670877    to: 673154    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g02510.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G14450.1); similar to unknown [Populus trichocarpa] (GB:ABK94107.1)
Range:  from: 673304    to: 674739    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version