AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                         <------ZmHOX2a(1)
                                                                                    <---------ALFIN1
                                                                                    --------->AtMYB61
                                                                                    ----------->RAV1(1)
                                                                                   --------->ANAC46
                                                                                   --------->MYB46(3)
                                                                                --------->MYB46(3)
                                                                               =================HOX2a_HOX2a
                                                                               <------ZmHOX2a(2)
                                                                              <---------ARR11(2)
                                                                              --------->GATA12
                                                                              --------->ARR11(2)
                                                                              --------->AGP1
                                                                              --------->RVE1(2)
                                                                              <---------ARR14(2)
                                                                              <---------GATA12
                                                                              --------->ARR11(3)
                                                                              <---------ARR11(3)
                                                                              --------->ARR14(2)
                                                                             --------->GLK1(1)
             --------->ANAC58       ----------->GT1                          --------->At4g35610
             --------->ANAC58    <---------STY1(2)                           <---------At4g35610
      --------->ANAC58   --------->HSFB2a(2)                             --------->LBD16--------->ANAC58
      --------->ANAC46  ----------------->AGL2                           ------>NtERF2  --------->ANAC46
      --------->ANAC58--------->ZAT18                                    <-----------HVH21        --
---------->GT1   ---------->DOF2 --------->STY1(2) --------->ANAC46    <---------LBD16  --------->ANAC58
 
aatggaaacaaggaagacgaaatagcgcccagaattagctagtaaaaacagtccaagtcaagtttaagacttgctccggcagatccaccacaggacacca  75100
                                                                                                  <-
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                                                                                                  <-
                                                                                                  --
                                                                                             <------MYB46(1)
                                                                                             <------MYB83
                                                                                             <------
                                                                                         --------->MYB55(2)
                                                                                         <---------MYB46(3)
                                           ----------->GT1                              --------->ALFIN1
                                         ---------->DOF2                        --------->ANAC46  --
                                      ------>NtERF2                          --------->TOE2(2)    --
                                      --------->LBD16                       <---------KAN1  <-------
                                     --------->DEAR3(1)                    --------->GATA12 <-------
                                    <------NtERF2                          <---------GATA12 --------
                                   ------>NtERF2---------->DOF2  <---------TOE1(2)    <-----------RAV1(1)
                                <-----------HVH21                <---------TOE2(3)  <---------KAN1<-
                               <-----------RAV1(1)               <---------TOE1(3) ------->TEIL <---
           --------->ZAT18   <---------KAN1--------->ANAC58      <---------TOE2(2) --------->GLK1(2)
------->RVE1(2)           <------ZmHOX2a(1)--------->ANAC58 --------->RVE1(2)--------->TOE1(2)------
 
aaatcagagacatgttcactaaaatcggaggaatttgtcgccgagaaagcaaaaagaaaacacaatccaaggttatggaatctacgaacctgtgggtggt  75200
          --------->ANAC46
       --------->ANAC58
       --------->ANAC58
       --------->ANAC46
     --------->ANAC46
------>ZmHOX2a(2)
--------AGP1
--------GATA12
--------ARR14(2)
------->GATA12
--------ARR11(3)
------->ARR11(3)       <---------LBD16
---MYB46(3)------>NtERF2--------->HSFB2a(2)      <---------GATA12
------->ARR14(2) <-----------------AGL1    --------->ANAC46         --------->ARR14(2)
------->ARR11(2) <-----------------AGL3    --------->ANAC58         <---------ARR11(3)
--DEAR3(1)--------->ANAC58 <---------ARR14(2)    <---------ARR11(3) --------->ARR11(3)
--AtMYB61 --------->ANAC58 --------->ARR14(2)    --------->GATA12   <---------ARR14(3)
->ALFIN1  --------->DEAR3(1)               --------->ANAC58         --------->ARR14(3)           ---
--------ARR11(2) ----------------->AGL3--------->HSFB2a(2)          <---------RVE1(2)            <--
------MYB46(3)   ----------------->AGL2<---------HSFB2a(2)          <---------ARR14(2)  --------->ZAT14
----------------->TaNAC69(2)       <---------DOF5.7(1) --------->At4g35610<---------ZAT6<---------ZAT14
 
ggatctatacacgacgcccctccattttcggaacttgctcttctccaagctaaatcttatctgaaatagaagatattgtgttacagactagtttactgag  75300
                           --------->At4g35610
                           <---------At4g35610
                   <------NtERF2
                  <---------ERF1
                  ------>NtERF2
                  <---------ATERF1(1)
                  <---------RAP2.3(1)
                 <---------ATERF1(2)
                 <---------RAP2.3(3)
                 <---------DEAR3(1)
                <---------ABI4(1)
                --------->ATERF1(1)
                --------->SPL7(1)             <---------AHL12(1)
               --------->ALFIN1               --------->KAN1
               ------>NtERF2                 <---------AHL12(1)
               <---------ATERF1(1)           --------->AHL12(1)
              <---------SPL7(1)              --------->AHL25(2)
              <---------MYB46(3)             --------->AHL12(3)
              <---------DEAR3(1)             <---------AHL25(3)
             <---------ANAC58                <---------AHL25(2)
    <-------GAMYB<---------RAP2.3(2)         <---------AHL25(1)
   <------MYB46(1)<---------DEAR4(2)         --------->AHL25(1)
   <------MYB83<------NtERF2                 <---------AHL12(2)
  <---------MYB46(3)   --------->ALFIN1     --------->AHL25(2)
  --------->MYB55(2)<---------DEAR3(1)      --------->AHL25(1)
 <---------MYB55(1)--------->ATERF1(1)      --------->AHL20(2)                        --------->ANAC46
 --------->ALFIN1--------->ATERF1(2)        <---------AHL25(2)                  --------->GLK1(1)
 <--------P  --------->ALFIN1               --------->AHL25(3)            <---------ETT(2)        --
<---------MYB52(1)<---------ORA47(2)        --------->AHL12(3)          <---------GATA12         ---
------>ZAT18 <---------ANAC46          ------>ZmHOX2a(1)                --------->ARR11(2)--------->At4g35610
-------LBD16 <---------ANAC58       ------>ZmHOX2a(1)                   --------->GATA12*TSS   <----
 
tccggtgggttacagggcgggcggcgatggagcagagtcctcctcaaaaaaattccagtcttcttcttatcgctcgatcgacgaattccaggcagtggca  75400
                                                                                        <------MYB46(1)
                                                                                        <------MYB83
                                                                                       <---------MYB46(3)
                                                                                       --------->MYB111(1)
                                                                                       --------->MYB59
                                                                                      <--------P
                                                                                     <-------GAMYB
                                                                                     <---------ANAC58
                                                                                     <---------ANAC58
                                                                                    --------->MYB52(2)
                                                                                    --------->MYB55(2)
                                                                                    <------MYB46(1)
                                                                                    <------MYB83
                                                                           <---------YAB1
                                                                          --------->AHL25(2)
                                                                          --------->AHL25(1)
                                                                          <---------AHL25(2)
                                                                          <---------AHL20(3)
                                                                          --------->AHL20(3)
                                                                          --------->AHL20(1)
                                                                          <---------AHL20(1)
  <------------CBF                       --------->ARR14(2)               --------->AHL20(2)    ----
<---------YAB1               --------->LBD16                              <---------AHL20(2)   -----
------->YAB5               <---------LBD16                               --------->AHL20(2)   ------
------>WRKY38(1)       <--------P        --------->ARR11(2)              --------->YAB1<---------AtMYB61
--------CBF    <----------DOF2 ------>NtERF2         --------->YAB5   --------->YAB5<---------MYB46(3)
 
ttgactattgctgcatttctttctgggtaagccgggcctctcggtataggcccaaaccattctaaggcccaaaccattatattaagttggttggtccacc  75500
                                                                           <------ZmHOX2a(2)
                                                                          --------->ARR11(2)
                                                                          <---------RVE1(2)
                                                                          --------->ARR14(2)
                                                                          --------->GATA12
                                                                          --------->ARR11(3)
                                                                          <---------ARR11(3)
                                                                          <---------ARR11(2)
                                                                          <---------GLK1(2)
                                                                          --------->ARR14(3)
                                                                          --------->AGP1
                                                                          <---------GATA12
         --------->ZAT2                                                   <---------ARR14(2)
         --------->At4g35610                                             --------->GLK1(1)
      <---------At4g35610                                                <---------GLK1(1)
      --------->At4g35610                                    <---------WOX13(2)       --------->LBD16
     ----------->RAV1(1)              <---------DOF5.7(1)    --------->WOX13(2)      --------->LBD16
   --------->ZAT2               <---------ZAT2              --------->MYB52(2)      <---------LBD16
   <---------ZAT2               --------->At4g35610         --------->MYB111(1)--------->TOE1(1)
   --------->At4g35610          --------->ZAT2              --------->MYB46(2)------>ZmHOX2a(1)<----
   <---------At4g35610          <---------At4g35610       <---------MYB52(1)------>ZmHOX2a(2)  <----
------>DOF2                  <---------At4g35610        ===========================HOX2a_HOX2a <----
---->AtMYB61       *TSS  <---------ARR14(2)             ==========================HOX2a_HOX2a  -----
--->ANAC46    <<<<<<<ZML2--------->ARR14(2)             ------>ZmHOX2a(1)--------->KAN1  <---------ATHB51
 
aaagtcagcagcagctagaacaagagcgactctgcagctgctcttctcccgcttccttcctgttagttagcctcagagatcctcgttccccgataatgga  75600
                          --------->At4g35610
                          --------->ZAT14
                          --------->ZAT2
                          <---------ZAT2
                          <---------At4g35610                                    --------->RVE1(2)
                       <---------At4g35610                                       --------->GATA12
                       --------->At4g35610                                       <-----------ARR10
                     --------->ZAT14                                             <---------GATA12
                     <---------ZAT14                                          <---------ALFIN1
                     --------->ZAT18                                          ----------->RAV1(1)
                   <---------RAP2.3(3)                                       --------->RAP2.3(3)
                 <-----------HVH21                                         ------>NtERF2
              <---------ZAT2                                              --------->DEAR3(1)
              --------->At4g35610                                        --------->ATERF1(1)
         <---------ARR11(2)                   --------->YAB1            <---------ATERF1(1)
         --------->ARR11(2)                   --------->YAB5          --------->ATERF1(1)
         <---------GATA12 <---------ZAT14     <---------ICU4         ------>NtERF2
-----GATA12------>ZmHOX2a(2)                 <---------YAB1<---------GLK1(2) --------->DEAR3(1)
-----ARR14(2) <---------At4g35610            <---------ATHB12       <---------PCF2
-----RVE1(2)<-----------RAV1(2)     <---------CCA1(2) <----------DOF2<---------ATERF1(1)
---->ARR14(2) --------->ZAT2   <---------ZAT18<--------HAHB4        <---------PCF5
 
tttgggaaaactgatccagctgtctgcgctgctgtgcccatttcttctatcattacactttagaatcgctggggcctccgcccacatctactcttcccag  75700
                                                                               --------->KAN1
                                                                               --------->KAN4(1)
                                                                               <---------KAN4(1)
                                                                               <----------TaMYB80
                                                                          --------->MYB59
                                                                  ------>ZmHOX2a(2)
                                                                  --------->YAB5
                                                                 <------ZmHOX2a(2)
                                                                <---------GATA12
                                                                --------->GATA12
                                                                <---------ARR11(2)
                                                                <---------ARR14(2)
                                       <------NtERF2            <---------ARR11(3)
                                    --------->ATERF1(1)      <---------HSFB2a(2)
                           ------>ZmHOX2a(1)    <---------KAN1  --------->ARR14(2)
              --------->KAN1        <------NtERF2            --------->HSFB2a(2)
            <---------MYB52(1)     ------>NtERF2--------->KAN1--------->LBD16 <---------KAN4(2)
            --------->At5g28300   --------->ALFIN1       <---------DOF5.7(1)  ---------->TaMYB80
         --------->DDF1  <------------------SPL14       <---------DOF5.7(1)----------->GT1
    --------->ANAC46    ------>ZmHOX2a(1)       <---------HSFB2a(1)<----------DOF2
 
cccttccacgatgtcggtaattctctcctcctctacggtggcagcgagggcatcttcgcctcttcccgatctttaatcaggtatattctatggattacat  75800
                                                                                                  <-
                                                                                                 <--
                                                                                                 ---
                                                                                                <---
                                                                                         <--------P
                                                                                        <-----------HVH21
                                                                                     <--------------
                                                                                     ---------------
                                                                                     <---------LBD16
                                                                                    <---------At5g28300
                                                                                    --------->MYB52(1)
                                                  <-----------RAV1(2)            <---------WOX13(2)
                                        <---------ALFIN1                         --------->WOX13(2)-
                                --------->KAN1   --------->ZAT14                --------->YAB5  ----
                               <---------YAB5    <---------ZAT14        <---------HSFB2a(2)---------
     <----------DOF2--------->ANAC46 ------>ZmHOX2a(1)                 <---------LBD16  <---------MYB52(1)
    <---------DOF5.7(1)  --------->ANAC46   ------>ZmHOX2a(1) <---------KAN1 <------ZmHOX2a(1) <----
 
tttcaactcttttgatgctctctactctactctactcatcctccctcctcactgcaggtttgagaacatcactctctggaggacaattaccggtaagggc  75900
                                                                                                ----
                                                                                              <-----
                                                                                             <------
                                                                     <---------LBD16         <------
                                                                    --------->MYB52(1)       -------
  ----------->RAV1(1)                                              <---------SPL7(1)      --------->At4g35610
--------->LBD16             ------>ZmHOX2a(2)                    --------->ZAT2    <------ZmHOX2a(2)
-----NtERF2                <---------YAB1                        --------->At4g35610     <----------
-------ATERF1(1)          <---------RVE1(2)              <---------MYB52(1)       <---------GATA12
--->NtERF2                --------->ARR11(3)           <---------DREB2C(2)        --------->ARR11(3)
------ALFIN1       --------->ANAC58                  --------->RVE1(2)            --------->RVE1(2)
---AGL1            --------->ANAC58         ------>ZmHOX2a(2)    <---------At4g35610------>ZmHOX2a(2)
-->AGL1    <--------P     <---------ARR11(3)----------->GT1  --------->ARR11(2)   <---------ARR11(3)
-------->DEAR3(1)  --------->ANAC46        <------ZmHOX2a(2) <---------ARR11(2)   <---------AGP1----
----->DEAR3(1)   ---------->DOF2          <---------GATA12 --------->MYB55(2)     --------->GATA12<-
>DOF5.7(1) <---------MYB52(1)<----------DOF2--------->YAB1 <---------MYB46(3)     --------->AGP1----
-----ABI4(2) --------->MYB52(2)           --------->GATA12--------->ALFIN1    ---------->DOF2-------
 
caccgcagcaatgggttagttcaagcagtgatctttgaagcctccgatcgtaacaatatcggtggttcagcttacggaggccaaagatctatttgctgca  76000
<- Previous    Next ->

AGI:  At2g01060.1   
Description:  myb family transcription factor. similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:AT3G13040.1); similar to myb family transcription factor [Arabidopsis thaliana] (TAIR:AT3G13040.2); similar to hypothetical protein [Vitis vinifera] (GB:CAN66505.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Myb, DNA-binding (InterPro:IPR014778); contains InterPro domain Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447)
Range:  from: 73258    to: 75389    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At2g01070.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G72480.1); similar to Os11g0546100 [Oryza sativa (japonica cultivar-group)] (GB:NP_001068063.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24763.1); similar to hypothetical protein OsJ_032883 [Oryza sativa (japonica cultivar-group)] (GB:EAZ18674.1); contains InterPro domain Transmembrane receptor, eukaryota; (InterPro:IPR009637)
Range:  from: 75520    to: 77865    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version