AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                <---------AtLEC2    --------->AHL20(2)
                                                                <---------ANAC46  --------->ANAC58
                                                  --------->AHL12(2)       <---------AHL25(3)
                                                  <---------AHL12(2)       <---------AHL12(3)
                                                 --------->AHL12(3)        --------->AHL25(1)
                                                 <---------AHL12(2)        <---------AHL20(2)
                                                <---------AHL25(2)         <---------AHL25(1)
                                                --------->AHL25(1)         --------->AHL12(3)
                                                <---------AHL25(1)        <---------AHL25(2)
                                                <---------ARR11(3)        --------->AHL25(3)
                                                --------->ARR11(3)        --------->AHL12(1)
                                                <---------AHL25(3)        <---------AHL12(1)
                                                --------->AHL20(3)        <---------AHL25(3)
                                                --------->AHL25(2)        <---------AHL20(2)
                                                --------->AHL25(3)        <---------AHL20(1)
                                                <---------AHL20(3)        --------->AHL20(1)
                                 <---------AHL12(3)            <------NtERF2      --------->ANAC58
        <---------YAB1           <---------AHL25(3)     <---------ANAC58  --------->AHL12(3)
      <-----------GT1            --------->AHL20(2)     <---------ANAC58  --------->AHL20(2)
  <---------AHL12(2)             --------->AHL25(2)--------->AHL20(3)     <---------AHL12(3)
  <---------YAB1                 <---------AHL25(1)<---------AHL20(3)     --------->AHL25(2)
 --------->AHL25(2)              <---------AHL25(2)--------->AHL12(3)     --------->AHL25(1)
 <---------AHL12(2)            --------->AHL25(2)--------->AHL12(2)       <---------AHL25(1)
 <---------AHL20(3)            --------->AHL20(3)<---------AHL12(3)      --------->AHL25(2)
 <---------AHL25(2)            <---------AHL20(3)--------->AHL12(1)      <---------AHL25(2)
 --------->AHL20(3)            --------->AHL20(2)<---------AHL20(2)      <---------AHL12(2)
 --------->AHL12(2)            <---------AHL25(2)<---------AHL12(1)      --------->AHL12(3)
--------->AHL25(3)            --------->YAB1    <---------AHL12(1)       <---------AHL12(3)
--------->AHL12(1)            --------->AHL12(2)--------->AHL12(1)       --------->AHL12(2)     ----
<---------AHL12(1)       <------MYB83           --------->AHL20(1)      --------->AHL12(2)      <---
--------GLK1(2)          <------MYB46(1)        --------->AHL20(2)      <---------AHL12(2)    ------
------>YAB5              ----------->GT1        <---------AHL20(1)     --------->AHL12(1)     ------
------ATHB12            --------->MYB59         <---------AHL20(2) ----------->GT1----------->GT1
---->DOF2       <---------MYB52(1)      ------->TEIL <<<<<<<<<<GT-3b   <---------AHL12(1)   --------
 
agattatttttactattcagttagtatttggtaaaataatatgtagcttaatatatttttcttggctgcatggaaaatttatttcaagtaaatacaaaag  30415200
                    --------->AHL20(2)
                 -------->HAHB4
                 --------->YAB5
                 --------->ATHB12
           --------->ANAC46
           --------->ANAC58
----->ARR11(3)  <---------YAB1     --------->ARR11(3)
------ARR11(3)  <---------ATHB12   <---------ARR11(3)                                    <----------DOF2
--->DOF5.7(1)   --------->ICU4   --------->DOF5.7(1)                             <-----------GT1
--->DAG2   --------->ANAC58    ---------->DOF2                                 --------->RVE1(2)
-->DOF2--------->ZAT6       --------->YAB1                                --------->RVE1(2)    <----
 
gtcttgactaacacaagaaatgattaaacaaaaataaaggtcttatcaatttgagttcaaaattagtattctgaacaaatcaaatcacattactttgaat  30415300
                    <---------ARR11(3)
                    --------->ARR11(3)                                                             <
                    <---------RVE1(2)                                                              -
                  <---------YAB1                                                         --------->ANAC58
                --------->YAB1                                                           --------->ANAC58
                <---------ICU4                                                      <---------TOE2(3)
               --------->ICU4                   --------->At4g35610             <----------DOF2    <
             --------->YAB1            --------->DAG2                         --------->ATHB12     <
       <-----------HVH21 --------->AHL20(2)     <---------At4g35610        --------->WOX13(2)      -
      ------->GAMYB--------->YAB1     ---------->DOF2             <----------DOF2   <---------TOE1(3)
   --------->MYB52(1)    <---------AHL20(2)  <---------YAB5  --------->KAN1<---------WOX13(2)     <-
-----KAN1    --------->YAB5           --------->DOF5.7(1)<-----------GT1 <---------AHL20(2)   ------
 
aagtctcaacggtcattgattatgatattaaaacaaaacaaaaaagtaatcagatgatttatactaattcttttattcaattgatttaaggcaagacttg  30415400
                              --------->YAB1
             --------->HSFB2a(2)        <---------AHL20(2)
         <---------ANAC58    <---------YAB1
       <---------KAN1        <---------YAB5
 <------NtERF2              --------->ARR11(3)
--------->LBD16             <---------ARR11(3)
---------ANAC46            --------->YAB5                                   <---------AHL12(2)
-------->HSFB2a(2)         --------->YAB1            ----------->GT1----------->GT1
---------HSFB2a(2)    <---------ANAC46 <---------ATHB12             <----------ID1                 <
---------ATERF1(2)    --------->ANAC55(2)          <---------YAB5---------->DOF2                  --
-------->ATERF1(2)    <---------ANAC55(2)   ----------->GT1  ----------------->AG             ------
--------LBD16<---------HSFB2a(2)      <---------WOX13(2)     ----------------->AGL1           <-----
--->KAN1 <---------ANAC58 <---------YAB1<---------AHL25(3)  <-----------------AGL1        ----------
 
tgccggaagaatacttgtggaagagacgtatgatcatagtcaataaatcgtttaatgagttatttcccaaaaggaaaaaaaaaaacagtttagaaaagga  30415500
                                <---------TOE2(3)
                                <---------TOE1(3)
                              ---------->DOF2                                      ---------->DOF2
                      --------->DOF5.7(1)           ---------->DOF2            ------>MYB83
                    ---------->DOF2          <---------WOX13(2)        --------->DAG2
               --------->AHL20(2)           --------->AHL12(1)         --------->DOF5.7(1)
---------TOE2(3) <---------AHL12(2)   <---------AtLEC2                --------->DOF5.7(1)
-------->DOF2  <---------AHL20(2)     <---------ANAC46               ---------->DOF2        *TSS
--->YAB5       --------->AHL20(3)     <---------ANAC58      ---------->DOF2    -------->P  <--------
-ZmHOX2a(1)    <---------AHL20(3)     <---------ANAC58     <---------KAN1      ------>MYB46(1)
>DOF2    --------->YAB1   ----------->GT1   <---------AHL12(1)--------->DOF5.7(1)--------->TOE2(3)
 
ttaaagatgaattcataaaaaaataaagaaggttaaaggttgcatgaaaatttagcaaaggaataaagagggaaaaggtcccaacctaaagaatacgata  30415600
                            <----------DOF2
                          ---------->ID1
                         <-----------GT1
                     <---------AHL25(2)
                     <---------AHL20(2)
                     --------->AHL25(1)
                     <---------AHL12(3)
                     --------->AHL12(2)                  --------->ANAC46          ---------->DOF2
                    --------->AHL12(1)                   --------->ANAC58      --------->ANAC58
                    <---------AHL12(1)    <---------AHL12(2)       <---------At4g35610           <--
                  <---------RVE1(2)      --------->AHL20(2)        --------->At4g35610      <------MYB46(1)
                <---------YAB1        --------->YAB1 <-----------GT1           --------->ANAC58  <--
-YAB1  <-----------GT1<---------AHL12(2)<---------KAN1   --------->ANAC58    ---------->DOF2<------MYB83
 
agacaactattttcgacttctgattttttttctttttgtaagaataaaaaacattttcacaagcctctgtagctgaagcacaaagcaaaagcatttggta  30415700
                 --------->YAB1
                 --------->YAB5
                 <---------ICU4
                 --------->ATHB12
                <---------ATHB12
         --------->ANAC58
         --------->ANAC46              --------->MYB52(1)       --------->GLK1(1)--------->DOF5.7(2)
         <----------ID1            <---------GATA12      <---------ANAC58        <---------MYB52(1)
         --------->ANAC58    <---------At4g35610         <---------ANAC58 --------------->AtSPL8
       ---------->DOF2       --------->At4g35610     <---------DOF5.7(1)  <---------------AtSPL3
   --------->MYB46(3)      <---------WRKY12          <----------DOF2     <---------ANAC46
 --------->ARR11(2)  <---------At5g28300       <---------ZAT18  <---------ARR14(2) <---------ARR11(3)
 <---------ARR11(2) <-----------GT1--------->GATA12 <---------DOF5.7(1)  <---------ANAC58       <<<<
-------ZAT6     --------->ICU4 ------->GAMYB   --------->ZAT18 --------->KAN1 ------->TEIL   <<<<<<<
-------YAB5    --------->RVE1(2)  --------->GLK1(1)<---------DOF5.7(1)   <---------ANAC58 <<<<<<<<<TBF1
 
gtcgtaaccaaaacgccaaatcattaccgttcaactgaaatctaacagagagccctcttttcttgggaattcgattccttgtacgttatcttcttcttct  30415800
                           --------->LBD16
                    --------->ARR11(2)
                    ------->TEIL
                    <---------ARR11(3)
                    --------->ARR11(3)
                    <---------ARR14(2)
                    <---------ARR11(2)                         --------->GATA12
                    --------->ARR14(2)                         <---------RVE1(2)
               <---------ANAC58         <---------RVE1(2)      <---------GATA12
               <---------ANAC58  <---------AHL12(1)          <------MYB83
               <---------ANAC46  --------->AHL12(1)   --------->DOF5.7(1)
   <----------DOF2 <---------CCA1(2)    --------->GATA12     <------MYB46(1)
  <---------DOF5.7(1)     <---------HSFB2a(2)        --------->DOF5.7(1)                     <------
<<<<<TBF1     <-------TEIL--------->HSFB2a(2)       ---------->DOF2                        ---------
<<TBF1     --------->KAN1<---------LBD16<---------GATA12   <--------P ---------->DOF2     ----------
 
tcttctctttctcaaaattcgtgtatcttctgggaaattttcagatttagatggagaaaggggttggatttgagaaagacatgaagacagtcagtgatgg  30415900
                                                --------->ANAC58
                                                --------->ANAC58
                                             <---------ATHB12
                                      --------->LBD16
                                     <---------ANAC58
                                     <---------ANAC58
                                     <---------ANAC46
     <---------TOE2(2)             ------>ZmHOX2a(2)      <-----------RAV1(2)
     <---------TOE1(2)            <------ZmHOX2a(2)      <------ZmHOX2a(2)
    <------NtERF2                --------->GATA12       --------->ARR11(3)                         -
  --------->ETT(1)               <---------GATA12       <---------ARR11(3)   <---------ANAC58     <-
<-----------HVH21         --------->AtMYB61<---------GLK1(1)                 <---------ANAC46    <--
---ANAC46                --------->MYB46(3)--------->GLK1(1)      <-----------GT1               ----
>ATHB12      <-----------GT1     <---------ARR11(3)   --------->DOF5.7(1)    <---------ANAC58  -----
->HVH21     <-----------GT1      --------->ARR11(3) ---------->DOF2>>>>>>>>>>>>>>>>>LFY     --------
 
gtttgtcggaggttttttccctgtctctaccaccaagatcgcgtggaaatcaagaaaaagatcaggttttttccactgtttcttgttttctcagaccatt  30416000
                                                       <---------AHL12(3)
                                                       <---------AHL25(3)
                                                       --------->AHL25(1)
                                                       <---------AHL20(2)
                                                       <---------AHL25(2)
                                                       <---------AHL25(1)
                                                       --------->AHL25(2)
                                                       --------->AHL12(3)
                                                      --------->AHL12(2)
                                                      <---------AHL12(1)
                                                      --------->AHL25(2)
                                                      <---------AHL25(2)
                                                      <---------AHL12(3)
                                                      --------->AHL25(3)
                                                      --------->AHL25(1)
          <----------DOF2                     --------->CCA1(2)
         <---------DOF5.7(1)<---------------AGL15     --------->AHL12(1)
    --------->HSFB2a(2)     --------------->AGL15     <---------AHL25(1)
    <---------HSFB2a(2)    <-----------------AGL3    <---------KAN1
 --------->GLK1(2)      <----------DOF2      <---------GATA12
<---------GLK1(2)      <---------DOF5.7(1)   --------->ARR14(2)
-------->KAN1       -------->P               <---------RVE1(2)
--------YAB5     --------->At4g35610         --------->ARR11(3)
-------TOE2(3)   <---------At4g35610         <---------ARR14(2)                                   --
------>DOF2  <---------WOX13(2)              --------->ARR11(1)                                   ==
---->AHL20(2)--------->WOX13(2)        ----------->HVH21       <---------YAB5                     ==
->YAB5 <---------ARR11(3)  <-----------------AGL2    --------->AHL12(1)                --------->ZAT18
 
aaagattctagacctttattagctaccctttctatttctggtctgaaagatttggaattttttttaagcatcaattgttttagctctatgtgaactattt  30416100
<- Previous    Next ->

AGI:  At1g80940.1   
Description:  similar to predicted protein [Populus alba x Populus tremula] (GB:AAR14272.1); contains domain PTHR22986:SF13 (PTHR22986:SF13); contains domain PTHR22986 (PTHR22986)
Range:  from: 30415593    to: 30417181    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version