AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                       ----------->RAV1(2)<------ZmHOX2a(2)              -----------
                                     <---------GLK1(1)   --------->ARR11(3)             --------->MYB46(3)
        ---------->DOF2       --------->ATHB12           <---------ARR11(3)     --------->YAB1 <----
------->MYB46(3)           --------->ANAC58             --------->YAB1---------->DOF2   --------->DEAR3(2)
------>ANAC58              --------->ANAC46  <---------DOF5.7(1) --------->AHL20(2)   --------->MYB52(1)
------>ANAC58              --------->ANAC58  <----------DOF2     <---------AHL20(2)--------->YAB1---
---->MYB46(3) ----------------------->TaNAC69(2)     ---------->DOF2  --------->DOF5.7(1)------->GAMYB
aaccaatttgtaaaagtttttctcttgttcaagtcattggaaacctgacttttcttcaaagatcatattaaaaaaaagaactataacaataaccgacaga  30353300
                 ------->MYC2                                                 ----------->GT1
                 <-------MYC4                                         ------>MYB83<---------WOX13(2)
       <---------At4g35610                                            ------>MYB46(1)
------->AHL12(2) ------->PIF5                                       <---------MYB59
->RAV1(1)        <-------PIF4    <---------MYB46(3)      --------->YAB1      --------->DOF5.7(1)
>HVH21------->TEIL    <---------At4g35610               <---------ATHB12     --------->DAG2
-----GLK1(2)    --------->KAN1   <-----------RAV1(1)  --------->WOX13(1)   ---------->DOF2   <------
------>AHL20(2)<-------TEIL    <----------DOF2---------->DOF2       --------->AtMYB61    --------->YAB5
ttatatatgtagctaaggcacatgcagcatcttcctttgttggcctcttgaaagtagcaatcaaactaagaccaaaccaaaaggtaactaaacgattcac  30353400
                 --------->ATHB12              <---------AHL25(3)
                <---------YAB1            --------->AHL25(2)
                --------->ICU4            <---------AHL20(2)
                <---------YAB5            <---------AHL20(3)
       <---------TOE1(2)                  --------->AHL20(3)
       <---------TOE2(2)                  <---------AHL20(1)
       ------->TEIL                       --------->AHL25(3)
       --------->SPL7(1)                  <---------AHL25(1)
       <-------TEIL                       --------->AHL20(2)
     --------->TOE1(2)                    --------->AHL20(1)
     <---------SPL7(1)                    --------->AHL25(1)          ----------->HVH21          <--
     --------->TOE2(2) ---------->ID1   <---------WOX13(2)        --------->MYB46(3)        <-------
   <---------------AtSPL3          <---------bZIP60(1)           -------->P            ------->TEIL-
   --------------->AtSPL8          --------->bZIP60(1)  --------->WOX13(2)       <---------ATHB51---
   --------------->AtSPL3 ------>ZmHOX2a(1)   --------->AHL20(2)--------->WOX13(1)  <---------YAB1 <
-----GT1      --------->YAB1  <---------At4g35610       <---------WOX13(2)       --------->ICU4-----
aacttcaacgtacgttttcatgatttgtccttctgatgatgtcaataaaataaaaactgaattgaatcaaccagtgatggagaaattatgcatcccatgt  30353500
     <----------ID1   <---------ARR11(3)
 ---------->DOF2      --------->ARR11(3)
-------WOX13(2) --------->ANAC46
--TOE1(2)   --------->RVE1(2)--------->AHL20(2)
-------->AHL20(2)   --------->ANAC58              ---------->DOF2                         <---------DOF5.7(1)
------>WOX13(2) --------->ANAC58             --------->KAN1                               <---------
---------AHL20(2)   --------->ANAC58        <---------KAN4(2)                   --------->AHL12(3)
---->AHL20(2)   --------->ANAC58  <---------AHL25(3)                            --------->AHL12(2) -
aattaaaagaaacaaaatcacacaagatattataaaataaaactaggtatattcaaaggcagtaaggccttacataagcccataaatattgggctttttt  30353600
                                       <---------MYB46(3)                       --------->WOX13(2)
                                    <---------RVE1(2)                           <---------WOX13(2)
                                   <------MYB46(1)                              <---------AHL12(2)
                                  --------->MYB59                     <---------RVE1(2)
                                --------->ICU4---------->DOF2         --------->ARR11(3)
           <---------YAB1      --------->WOX13(2)                     <---------ARR11(3)    *TSS
         --------->YAB1        <---------WOX13(2)                    <---------RVE1(1)  --------->STY1(1)
        <---------YAB1     ----------->GT1  <------NtERF2       ---------->DOF2 --------->AHL12(2)
    --------->YAB1     --------->LBD16 <---------AtMYB61    --------->ZAT6  <---------WOX13(2)
-DOF2 <---------ZAT6  <------NtERF2<------MYB83    ----------->GT1--------->DOF5.7(1)   <---------STY1(1)
----------->CBF      <---------LBD16--------->GATA12    <---------WOX13(2)  --------->WOX13(2) <----
agcccaatagtattatgagtctggcccggagcgtaattaggtctggtggcaaagttgttaataacacaaaagagattttagttaataaaccctaggcttc  30353700
                                             ------>NtERF2           <---------MYB52(1)
                                             <---------SPL7(1)      --------->LBD16
                                            --------->RAP2.6(2)     ----------->GT1
                                            --------->RAP2.3(2)   <------NtERF2
                                            --------->DEAR3(1)   ------>NtERF2
                                           --------->DEAR4(2)    --------->MYB52(1)
                                           --------->ORA47(2)   <---------ALFIN1
                                           <------NtERF2        --------->DEAR3(1)
                                           --------->RAP2.3(1) <---------ABI4(2)
                                           --------->ATERF1(1) --------->ATERF1(1)
                                          ------>NtERF2        --------->MYB46(3)
                                          <---------ATERF1(1)  --------->ERF1
                                         --------->RAP2.6(2)   <------NtERF2
                                         --------->RAP2.3(2)   ----------->HVH21
                                         --------->RAP2.3(3)  <---------ATERF1(1)
                                         --------->DEAR3(1)   ------>NtERF2
                                         ------->GAMYB        <---------RAP2.6(3)         <---------ANAC58
                                        --------->DEAR3(2)   --------->RAP2.6(2)          <---------ANAC58
               <---------MYB111(1)      --------->ERF1       --------->ANAC46            -----------
               <---------MYB111(2)      --------->ATERF1(1)  --------->DEAR3(1)       <---------DOF5.7(1)
 --------->RAP2.6(3)                    --------->RAP2.3(1)  <---------ATERF1(2)     <---------DOF5.7(1)
<---------ARR14(2)                      --------->MYB46(3)   --------->ATERF1(2)     <---------DAG2
<---------GATA12                       --------->At4g35610  ----------------->AGL1   <----------DOF2
--------->ARR14(2)                     <---------At4g35610  <---------RAP2.6(2)     <---------DOF5.7(1)
--------->GATA12 ------>MYB83 --------->GLK1(1)         <----------DOF2             <---------DAG2 <
--------->ARR11(2)            <---------GLK1(1)        <---------ANAC58            <---------DOF5.7(1)
-------------AGL1------>MYB46(1)  <----------DOF2      <---------ANAC58  <---------WOX13(2) <-------
tcaaatcggccattgctaccaacttcgacttggaattctttcagccgccgtcccaattgctttgccgccaccggtaaatttgttcccccttttccgttct  30353800
                 <------MYB46(1)                                                     --------->AHL20(2)
                 <------MYB83                                                        --------->AHL25(2)
               <---------MYB52(1)                                                    <---------AHL25(2)
        --------->KAN1                         <-------GAMYB                         --------->AHL25(1)
---->AtSPL8   <-------GAMYB             <---------YAB1                   <----------DOF2     <------
---------CCA1(2)<---------AtMYB61   <----------DOF2   --------->ZAT14    <---------DAG2--------->AHL12(1)
--MYB52(1)   <-----------RAV1(1) <---------ALFIN1     <---------ZAT14 <-----------GT1--------->AHL12(3)
tcttatcttgttcattctgttggtgtccctatagcctcactttcttatagggttgagttcagtctctgtttataaacttttttcgcaaaaaaattcaatc  30353900
                <---------HSFB2a(2)                                               <---------------AtSPL3
              <---------REM1(1)                                                  <---------RVE1(2)
              <---------ANAC46                  <------ZmHOX2a(1)         --------->MYB52(1)
      <---------MYB52(1)              <---------ICU4                   --------->ANAC55(2)
 --------->GLK1(2)  --------->ANAC58--------->ARR11(3)    <---------TOE1(3)  --------->LBD16
-->GATA12  <-----------RAV1(1)      <---------RVE1(2)    --------->MYB52(1)<---------LBD16        <-
---GATA12<---------ANAC46--------->DOF5.7(1)  <---------TOE2(3)        <---------ANAC55(2)    ------
tgacaatctgttttgtgttgtagaagcaaagagtagagagataatggctgaggaagaagctaagggtttggattacataccggagatagtactgaagaag  30354000
                    <----------DOF2                     --------->LBD16
                    <---------DOF5.7(1)                 ------>NtERF2
                   <---------DOF5.7(1)                 <---------ETT(1)
                   <---------------AGL15               <---------LBD16                             <
                   --------------->AGL15       <---------ANAC46                                    <
                  ----------------->AGL1       <------MYB83                                        <
                  ----------------->AGL2       <------MYB46(1)                                     -
              <---------ANAC58   --------->ANAC58     <---------LBD16                              -
              <---------ANAC58   --------->ANAC46     --------->RAP2.6(3)                          <
             --------->ZAT2 <------ZmHOX2a(1)  ----------->GT1                                     <
        --------->CCA1(2)<---------LBD16      <---------MYB46(3)                              ------
-----ZmHOX2a(1)   ----------------->AGL3      --------->MYB59       >>>>>>>>>TBF1  --------->RVE1(2)
--->DOF5.7(1)--------->At4g35610 --------->ANAC58 --------->KAN1 >>>>>>>>>TBF1    --------->GLK1(1)<
aggaagaacagagatgagcttgcctttatcaggaagaagcaacttgagttgggtaattccggcaagaagaagaagaaagtctctgatatcaaacgtcctg  30354100
---------GATA12                    <---------DOF5.7(1)
---------GLK1(2)            <---------ALFIN1 --------->ARR11(2)         <---------DOF5.7(1)
---------ARR14(3)          <---------ZAT18   --------->ARR14(2)        <----------DOF2
-------->ARR14(3)          --------->ZAT18   <---------ARR14(2)       <---------DOF5.7(1)
-------->ARR11(3)          <-------TEIL<-----------GT1               ---------->ID1
---------ARR11(3)      <---------------AtSPL8<---------GLK1(2)   <----------DOF2       <---------At5g28300
---------RVE1(2)       <---------TOE2(3)  --------->HSFB2a(2)   <---------ANAC58      <-----------GT1
>ZmHOX2a(1)   <---------ZAT14     <----------DOF2          <----------DOF2<-----------GT1         <-
---------ARR14(2)      <---------TOE1(3)  <---------HSFB2a(2)   <---------ANAC58    <----------DOF2
aagattttgttcatgagttcagggctaaggtacacttctttttttccagattctctgaaaaacttttgctttgtctttttccattcgttttactgcctca  30354200
<- Previous    Next ->

AGI:  At1g80745.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G15420.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39247.1)
Range:  from: 30352606    to: 30353328    Orientation: Forward
Links:  TAIR  MIPS  AIP 
AGI:  At1g80750.1   
Description:  60S ribosomal protein L7 (RPL7A). Identical to 60S ribosomal protein L7-1 (RPL7A) [Arabidopsis Thaliana] (GB:Q9SAI5); similar to 60S ribosomal protein L7 (RPL7D) [Arabidopsis thaliana] (TAIR:AT3G13580.1); similar to 60S ribosomal protein L7 (RPL7D) [Arabidopsis thaliana] (TAIR:AT3G13580.3); similar to 60S ribosomal protein L7 (RPL7D) [Arabidopsis thaliana] (TAIR:AT3G13580.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO45481.1); contains InterPro domain Ribosomal protein L30, N-terminal (InterPro:IPR012988); contains InterPro domain Ribosomal protein L7, eukaryotic; (InterPro:IPR005998); contains InterPro domain Ribosomal prote
Range:  from: 30353693    to: 30355456    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version