AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                        <-----------GT1                    --------->DOF5.7(1)
                    <---------GLK1(2)                <----------ID1
                    <---------RVE1(2)     --------------->AGL15
         --------->ARR11(3)              ----------------->AGL2
         --------->RVE1(2)               <-----------------AGL2
         <---------GATA12                <-----------------AGL3            <----------DOF2
         <---------ARR11(3)              ----------------->AGL1     <----------DOF2
  --------->REM1(1) <---------GATA12     ----------------->AGL3    <---------DOF5.7(1)  <---------AHL20(2)
----->DOF2          <---------ARR11(3)   ----------------->AG<---------GLK1(2) <---------ZAT6
>GT1    <---------GLK1(2) --------->ANAC46<---------------AGL15   ------>ZmHOX2a(1) --------->AHL12(2)
aagcttcaacaaaatctcacacagattttacgaaaaacacattagccaaatatagaaggaaaaagattcctctttgaactttgtgttatattttctttgg  30319000
          <---------DEAR3(1)     --------->ATERF1(1)
          <---------AtMYB61      <------NtERF2
          ----------->HVH21     <---------ATERF1(1)
         --------->ATERF1(1)    --------->LBD16
       <---------DEAR3(1)     <---------LBD16
      <---------LBD16   --------->ZAT14
   <---------ZAT2    <---------ANAC58                --------->YAB1    --------->ANAC58
   --------->ZAT2    <---------ANAC46         --------->ANAC46      <---------ZAT18
   --------->At4g35610  --------->REM1(2)    XXXXXXXXXXXXXXXXXXXX>MIR841     --------->KAN1
   <---------At4g35610  <---------ZAT14   <-----------GT1        <---------ANAC58          ---------
  --------->MYB111(2)<---------ANAC58  --------->ANAC58          <---------ANAC46   <---------DOF5.7(1)
 <--------P------>NtERF2--------->ZAT18--------->ANAC58 <-----------GT1--------->ANAC58  -------->P
<---------MYB52(1) <---------ANAC46------>NtERF2<---------ZAT18  <---------ANAC58  <---------DOF5.7(1)
acaggtagctgcggtggcggtgttgtgtgtacagccggagccaagttacagaccacttataaccgatgtcttgcactcactcatccctcttctaccagta  30319100
             <---------LBD16                                                     ------->TEIL
         <---------ICU4                                <---------ANAC46       <---------YAB1
         --------->ATHB12                              <---------ANAC58 <---------ANAC58         <--
         --------->YAB5                      <---------DOF5.7(1)        <---------ANAC58         <--
        <---------YAB5                      <----------DOF2       <------ZmHOX2a(2)   ---------->ID1
        <------ZmHOX2a(2)               <----------DOF2<---------ANAC58 <---------ANAC46 <---------DOF5.7(1)
        <---------YAB1                  <---------DOF5.7(1)      --------->RVE1(2)<---------KAN1 <--
>ZAT6<---------MYB46(3)                <---------DOF5.7(1)  <-----------GT1<---------ARR11(2)<------
gaactcggtggatcattgcggattttataaaaaaacatttcccctttctttttttttttcttgtaacagatcaatgcgtttatgaatttgtctcttatgt  30319200
             --------->AHL25(2)                              <----------DOF2
             <---------AHL20(2)              --------->AHL12(1)
             --------->AHL12(1)             --------->AHL12(1)
           --------->AHL12(2)               <---------AHL25(2)
      --------->LBD16                       --------->AHL25(2)
     <---------ANAC46                       <---------AHL12(1)
     --------->HSFB2a(2)                    <---------AHL25(1)                                 <----
     <---------HSFB2a(2)                    --------->AHL20(2)                   --------->ANAC58  -
    <---------LBD16      --------->YAB5     --------->AHL20(3)       --------->ARR11(2)        <----
----MYB83  --------->GLK1(2)<---------AHL20(2)              <---------ANAC58     --------->ANAC58<--
----MYB46(1) <---------AHL25(2)             --------->AHL25(1)       <---------ARR11(2)        <----
-------MYB46(3) <---------YAB1  <---------ICU4  <---------LBD16      <---------ARR14(2)   <---------ZAT6
-----RAV1(1) --------->AHL20(3)<---------YAB5--------->KAN1 <---------ANAC58 --------->CCA1(2)------
tggttcttccggagaatttattgttgtatgtttaatcactgctacaaaaaattcggaagttttgcttaaatggaaccgagagacaagttagtagagtttg  30319300
                                                 --------->WRKY12                               <---
                                                 --------->WRKY45                               <---
                                                 --------->WRKY38(1)                          <-----
                                        --------->AHL20(2)                                    ------
                                     <---------AHL25(3)                                       <-----
                                     --------->AHL20(2)                                     --------
                                    --------->AHL20(2)                                      <-------
                                    --------->AHL12(3)                                      --------
                                    --------->AHL12(1)                                      <-------
                                    <---------AHL25(1)                                     <--------
                                    --------->AHL25(1)                                    <---------AHL12(1)
                                    --------->AHL20(3)                                    --------->AHL12(1)
                                    <---------AHL20(2)                                    --------->AHL25(1)
                                    <---------AHL20(3)                                    <---------AHL25(1)
                                    <---------AHL12(3)                                    <---------AHL25(2)
                                    <---------AHL12(1)                                    --------->AHL25(3)
                                    --------->AHL25(3)                                    --------->AHL20(3)
                                   --------->AHL12(2)                                     --------->AHL20(1)
                                <---------AHL20(2)                                        <---------AHL12(3)
                                --------->AHL20(2)                                        <---------AHL25(3)
   ---------->DOF2     <----------DOF2<---------AHL12(2)                                  --------->AHL25(2)
-----MYB46(3)----------->GT1    --------->AHL20(3)       --------->YAB1                   <---------AHL20(2)
---------->GT1    ---------->DOF2  <---------AHL12(2)  <-----------TBP       --------->ALFIN1 <-----
--MYB83     ----------->GT1     ----------->TBP --------->DOF5.7(2)          <---------ANAC46 ------
------P    <---------TOE1(3)    --------->AHL25(1)   <---------DAG2   <-------GAMYB   --------->AHL20(2)
--MYB46(1) <---------TOE2(3)    --------->AHL12(3)   <----------DOF2 <---------MYB46(3)   --------->AHL20(2)
--->MYB59---------->DOF2   >>>>>>>>>MYB98<---------AHL25(3)          --------->MYB52(2)  --------->AHL25(3)
gttagtaaaagttaaaggtttaaaagctttaacatataaataaataaaaacgttgactttttataacagagtttgttgttgtggggaaatgaattaatta  30319400
     --------->RVE1(2)                    --------->HSFB2a(2)
    --------->KAN1               <-----------GT1
  <---------DAG2               --------->AHL12(1)
  --------->TOE2(3)           <---------AHL20(3)
  --------->TOE1(3)           --------->AHL25(2)
  <---------DOF5.7(1)         <---------AHL25(2)
------->TEIL                  --------->AHL12(2)
-----------GT1                --------->AHL20(3)                 --------->LBD16
----->WOX13(2)                <---------AHL12(2)               <---------LBD16
----------->AtSPL8            <---------AHL12(1)             <---------ARR11(3)
------TOE2(3)                 --------->AHL12(1)             --------->ARR14(2)
------WOX13(2)               <---------AHL12(2)              --------->ARR11(3)
----AHL20(2)                 --------->AHL12(2)              <---------ARR14(2)
--->AHL25(1)                <---------AHL20(2)              <---------GLK1(1)
----AHL25(1)                --------->AHL25(1)              --------->CCA1(1)
->AHL12(2)                  <---------AHL25(2)              --------->RVE1(1)
--WOX13(2)                  <---------AHL12(3)              --------->GLK1(1)
->WOX13(2)                 --------->AHL20(2)               <---------RVE1(1)
--AHL12(2)                 *TSS<---------AHL12(1)          --------->ARR11(3)                 ------
-AHL25(3) <---------MYB52(1)--------->AHL12(2)         ---------->DOF2                      --------
----AHL25(3)               --------->AHL25(3)      ---------->DOF2    <---------KAN1      <---------YAB1
--->AHL20(2)           ------>ZmHOX2a(2) <-----------GT1   <---------ARR11(3)      ----------->GT1
atgaaccttatccgttttgtcgatgatcgataaaattttcaatttctcgattcccaaagaaagatatctgggaattagacaaggagtagtaatatgaaag  30319500
         <---------ARR11(2)                     <---------YAB1                  <---------HSFC1(2)
         --------->ARR14(2)                   --------->YAB1             ------>ZmHOX2a(1)
         --------->ARR11(2)                  <------ZmHOX2a(2)        ------>ZmHOX2a(1)
     <-----------RAV1(2)                     ================================HOX2a_HOX2a     <------
    <------ZmHOX2a(2)                    <------ZmHOX2a(2)      --------->KAN1  --------->HSFB2a(1)
   <---------ARR11(2)                    ====================================HOX2a_HOX2a     -------
   <---------ARR14(2)        --------->DOF5.7(1)<---------YAB5 --------->ARR11(3)            -------
   --------->ARR14(2)--------->GLK1(1)  --------->RVE1(2)      <---------RVE1(2)--------->HSFC1(2)
   --------->ARR11(2)<---------KAN1     <---------GATA12       <---------ARR11(3)  <---------DOF5.7(1)
   <---------GATA12 <---------ARR11(2)  --------->ARR11(3)     --------->ARR14(2)<---------DOF5.7(1)
  <------ZmHOX2a(1) --------->ARR11(2)  --------->GATA12      --------->YAB1<---------ETT(2)<-------
--->DOF5.7(1)   <---------At4g35610     <---------ARR11(3) ---------->DOF2 --------->HSFB2a(2)     <
-->DOF2 <------ZmHOX2a(1)   ---------->DOF2  ===================================HOX2a_HOX2a <-------
atggaggatcaggaaacgaagcggataaccaaaaaaccgtcaagatcgatcatcatcagtctcaaagatattcctcctctcgacccttcttctattccct  30319600
         <-------TEIL                                        ----------->RAV1(2)
         <---------YAB5                                   <---------YAB5
      --------->AHL12(1)                           <---------AHL25(2)
      --------->KAN1                               --------->AHL25(2)
      <---------AHL12(1)                           --------->AHL12(1)
     --------->ICU4                                <---------AHL25(3)
     <---------YAB5                                --------->AHL20(1)
     <---------AHL12(2)   <---------GLK1(2)        <---------AHL20(2)
     --------->AHL12(2)   --------->ARR14(2)       <---------AHL12(1)
 --------->At5g28300      <---------ARR14(2)       <---------AHL25(1)
----------->GT1          --------->KAN1            --------->AHL20(2)
--------->YAB1         --------->TOE2(3)          --------->AHL12(3)
---------AGL15         --------->YAB1             --------->AHL25(3)
-------->AGL15        <---------ATHB12            <---------AHL25(2)
---------->AGL1      -------->P                   --------->AHL25(2)
----------AG         ------>MYB46(1)              --------->AHL25(1)
---------TOE2(3)     ------>MYB83  <----------DOF2--------->AHL20(2)                             ---
----------AGL1  --------->ANAC46  <---------DOF5.7(1)    <---------RVE1(2)      <---------KAN4(2)<--
ctatggtaaatattcattcactccaaccatattctcttctttctcgctaacaaaaaaattgatcatctgggtttgaaacagagaacaatctctgcgtttt  30319700
              <<<<<<<<<TBF1                        --------->ICU4            <---------WOX13(2)  <--
        --------->YAB5                           --------->YAB1     <---------ANAC58           <----
     <---------At4g35610                      ----------->GT1       <---------ANAC58    --------->MYB46(3)
------------>AGL15                     ----------->GT1 --------->CCA1(1) <-----------HVH21--------->MYB52(1)
-------------AGL15     <---------RVE1(2)      --------->YAB1    <----------DOF2        <<<<<<<<<<<<<
ctatttgtagatgattcttcttctgtgatttggctatatcatgggttaatagtaataaatatctcaactttgcttctgtcaattgttagaaaccaatggc  30319800
----NtERF2                 --------->GLK1(2)
-----ANAC46              --------->KAN1
<<<<LFY      --------->ALFIN1                             >>>>>>>>>TBF1             --------->HSFB2a(2)
gcaagatcatcataatgtgggaatgcagagattccaagagaagactgacttcaagtttgaagaagaagacaatgccatttcttccttctctaacattcaa  30319900
<- Previous    Next ->

AGI:  At1g80640.1   
Description:  protein kinase family protein. similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT2G25220.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN79180.1); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Tyrosine protein kinase; (InterPro:IPR001245)
Range:  from: 30316558    to: 30319267    Orientation: Forward
Links:  TAIR  MIPS  AIP 
AGI:  At1g80650.1   
Description:  RTL1 (RNASE THREE-LIKE PROTEIN 1); double-stranded RNA binding. similar to double-stranded RNA-binding domain (DsRBD)-containing protein [Arabidopsis thaliana] (TAIR:AT4G00420.3); similar to double-stranded RNA-binding domain (DsRBD)-containing protein [Arabidopsis thaliana] (TAIR:AT4G00420.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO67716.1); contains InterPro domain Double-stranded RNA-binding-like; (InterPro:IPR014720); contains InterPro domain Double-stranded RNA binding; (InterPro:IPR001159)
Range:  from: 30319428    to: 30320711    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version