AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                            --------->YAB5
                        <-----------GT1                    --------->DOF5.7(1)
                    <---------GLK1(2)                <----------ID1
                    <---------RVE1(2)     --------------->AGL15
         --------->ARR11(3)              ----------------->AGL2
         --------->RVE1(2)               <-----------------AGL2
         <---------GATA12                <-----------------AGL3            <----------DOF2
         <---------ARR11(3)              ----------------->AGL1     <----------DOF2
  --------->REM1(1) <---------GATA12     ----------------->AGL3    <---------DOF5.7(1)  <---------AHL20(2)
----->DOF2          <---------ARR11(3)   ----------------->AG<---------GLK1(2) <---------ZAT6
>GT1    <---------GLK1(2) --------->ANAC46<---------------AGL15   ------>ZmHOX2a(1) --------->AHL12(2)
 
aagcttcaacaaaatctcacacagattttacgaaaaacacattagccaaatatagaaggaaaaagattcctctttgaactttgtgttatattttctttgg  30319000
                --------->ALFIN1
               <------NtERF2
             <---------DREB2C(2)
             <---------DEAR3(1)
             <---------ANAC46
            <---------ABI4(1)
            <------NtERF2
            --------->ATERF1(1)
          --------->ALFIN1
          <---------DEAR3(1)     --------->ATERF1(1)
          <---------AtMYB61      <------NtERF2
          ----------->HVH21     <---------ATERF1(1)
         --------->ATERF1(1)    --------->LBD16
       <---------DEAR3(1)     <---------LBD16
      <---------LBD16   --------->ZAT14
   <---------ZAT2    <---------ANAC58                --------->YAB1    --------->ANAC58
   --------->ZAT2    <---------ANAC46         --------->ANAC46      <---------ZAT18
   --------->At4g35610  --------->REM1(2)    XXXXXXXXXXXXXXXXXXXX>MIR841     --------->KAN1
   <---------At4g35610  <---------ZAT14   <-----------GT1        <---------ANAC58          ---------
  --------->MYB111(2)<---------ANAC58  --------->ANAC58          <---------ANAC58   <---------DOF5.7(1)
 <--------P------>NtERF2--------->ZAT18--------->ANAC58 <-----------GT1--------->ANAC58  -------->P
<---------MYB52(1) <---------ANAC46------>NtERF2<---------ZAT18  <---------ANAC46  <---------DOF5.7(1)
 
acaggtagctgcggtggcggtgttgtgtgtacagccggagccaagttacagaccacttataaccgatgtcttgcactcactcatccctcttctaccagta  30319100
                    <---------AHL20(2)
                 <---------ARR14(2)
                 <---------GATA12
                 --------->GATA12
                 <---------RVE1(2)
                 <---------ARR11(2)
                 --------->ARR14(2)
               --------->LBD16
              <---------ANAC46
              <---------ANAC58
              <---------ANAC58
             <---------LBD16                                                     ------->TEIL
         <---------ICU4                                <---------ANAC58       <---------YAB1
         --------->ATHB12                              <---------ANAC46 <---------ANAC46         <--
         --------->YAB5                      <---------DOF5.7(1)        <---------ANAC58         <--
        <------ZmHOX2a(2)                   <----------DOF2       <------ZmHOX2a(2)   ---------->ID1
        <---------YAB1                  <----------DOF2<---------ANAC58 <---------ANAC58 <---------DOF5.7(1)
        <---------YAB5                  <---------DOF5.7(1)      --------->RVE1(2)<---------KAN1 <--
>ZAT6<---------MYB46(3)                <---------DOF5.7(1)  <-----------GT1<---------ARR11(2)<------
 
gaactcggtggatcattgcggattttataaaaaaacatttcccctttctttttttttttcttgtaacagatcaatgcgtttatgaatttgtctcttatgt  30319200
              <---------AHL25(3)
             <---------AHL20(1)
             <---------AHL20(3)
             --------->AHL25(3)
             <---------AHL25(3)
             <---------AHL25(1)
             --------->AHL20(1)
             --------->AHL12(1)
             --------->AHL25(1)
             --------->AHL20(2)
             --------->AHL25(2)                              <----------DOF2
             <---------AHL20(2)              --------->AHL12(1)
             <---------AHL12(1)             --------->AHL25(2)
           --------->GLK1(2)                <---------AHL25(2)
      --------->LBD16                       <---------AHL25(1)
     <---------HSFB2a(2)                    --------->AHL25(1)
     <---------ANAC46                       --------->AHL20(2)                                 <----
     --------->HSFB2a(2)    <---------AHL20(2)              <---------ANAC58     --------->ANAC58  -
    <---------LBD16      --------->YAB5     --------->AHL20(3)                   --------->ANAC58<--
----MYB83  --------->AHL12(2)               <---------AHL12(1)       <---------ARR14(2)        <----
----MYB46(1) --------->AHL20(3)             --------->AHL12(1)       <---------ARR11(2)        <----
-------MYB46(3) <---------YAB1  <---------ICU4  <---------LBD16      --------->ARR11(2)   <---------ZAT6
-----RAV1(1) <---------AHL25(2)<---------YAB5--------->KAN1 <---------ANAC58 --------->CCA1(2)------
 
tggttcttccggagaatttattgttgtatgtttaatcactgctacaaaaaattcggaagttttgcttaaatggaaccgagagacaagttagtagagtttg  30319300
                                                                                                   <
                                                                                                <---
                                                                                                <---
                                                 --------->WRKY12                               ----
                                                 --------->WRKY45                               ----
                                                 --------->WRKY38(1)                          <-----
                                        --------->AHL20(2)                                    <-----
                                     <---------AHL25(3)                                       <-----
                                     --------->AHL20(2)                                     --------
                                    <---------AHL20(3)                                      <-------
                                    <---------AHL20(2)                                      --------
                                    --------->AHL20(3)                                      <-------
                                    <---------AHL12(3)                                     <--------
                                    --------->AHL12(3)                                    --------->AHL12(1)
                                    --------->AHL20(2)                                    <---------AHL12(1)
                                    --------->AHL12(1)                                    --------->AHL25(1)
                                    --------->AHL25(1)                                    <---------AHL25(1)
                                    --------->AHL25(3)                                    <---------AHL25(2)
                                    <---------AHL25(1)                                    --------->AHL25(3)
                                    <---------AHL12(1)                                    --------->AHL20(3)
                                   <---------AHL12(2)                                     --------->AHL20(1)
                                --------->AHL25(1)                                        <---------AHL12(3)
                                <---------AHL20(2)                                        <---------AHL25(3)
   ---------->DOF2     <----------DOF2<---------AHL12(2)                                  --------->AHL25(2)
--MYB83     ----------->GT1     --------->AHL12(3)       --------->YAB1                   <---------AHL20(2)
---------->GT1    ---------->DOF2  --------->AHL12(2)  <-----------TBP       --------->ALFIN1 ------
------P    <---------TOE2(3)    ----------->TBP --------->DOF5.7(2)          <---------ANAC46 ------
-----MYB46(3)----------->GT1    --------->AHL20(3)   <---------DAG2   <-------GAMYB   --------->AHL20(2)
--MYB46(1) <---------TOE1(3)    --------->AHL20(2)   <----------DOF2 <---------MYB46(3)   --------->AHL20(2)
--->MYB59---------->DOF2   >>>>>>>>>MYB98<---------AHL25(3)          --------->MYB52(2)  --------->AHL25(3)
 
gttagtaaaagttaaaggtttaaaagctttaacatataaataaataaaaacgttgactttttataacagagtttgttgttgtggggaaatgaattaatta  30319400
     --------->RVE1(2)
     <---------ARR11(2)
     --------->ARR11(2)                   --------->HSFB2a(2)
    --------->KAN1               <-----------GT1
  --------->TOE2(3)            --------->AHL12(1)
  <---------DOF5.7(1)         <---------AHL12(2)
  <---------DAG2              --------->AHL12(1)
  --------->TOE1(3)           --------->AHL25(2)
------->TEIL                  --------->AHL20(3)
-----------GT1                <---------AHL20(3)                 --------->LBD16
------WOX13(2)                <---------AHL12(1)               <---------LBD16
------TOE2(3)                 --------->AHL12(2)             --------->ARR11(3)
----->WOX13(2)                <---------AHL25(2)             <---------ARR11(3)
----------->AtSPL8           <---------AHL12(2)              <---------ARR14(2)
----AHL25(3)                 --------->AHL12(2)              --------->ARR14(2)
----AHL20(2)                <---------AHL12(3)              --------->RVE1(1)
----AHL25(1)                <---------AHL20(2)              <---------GLK1(1)
->AHL12(2)                  <---------AHL25(2)              --------->GLK1(1)
--WOX13(2)                  --------->AHL12(2)              --------->CCA1(1)
->WOX13(2)                 --------->AHL20(2)               <---------RVE1(1)
--AHL12(2)                 *TSS<---------AHL12(1)          <---------ARR11(3)                 ------
-AHL25(3) <---------MYB52(1)--------->AHL25(1)         ---------->DOF2                      --------
--->AHL25(1)               --------->AHL25(3)      ---------->DOF2    <---------KAN1      <---------YAB1
--->AHL20(2)           ------>ZmHOX2a(2) <-----------GT1   --------->ARR11(3)      ----------->GT1
 
atgaaccttatccgttttgtcgatgatcgataaaattttcaatttctcgattcccaaagaaagatatctgggaattagacaaggagtagtaatatgaaag  30319500
                                                   <---------YAB5
                                                 <---------ICU4
                                                 --------->YAB1
         <---------ARR11(2)                     <---------YAB5                  --------->HSFB2a(1)
         --------->ARR14(2)                   --------->YAB1             ------>ZmHOX2a(1)
         --------->ARR11(2)                  ===================================HOX2a_HOX2a
     <-----------RAV1(2)                     <------ZmHOX2a(2)        ------>ZmHOX2a(1)      -------
    <------ZmHOX2a(2)                    <------ZmHOX2a(2)      --------->KAN1  <---------HSFC1(2)
   <---------ARR14(2)                    ====================================HOX2a_HOX2a     -------
   <---------ARR11(2)        --------->DOF5.7(1)<---------YAB1 --------->ARR14(2)            <------
   --------->ARR11(2)--------->GLK1(1)  <---------GATA12       --------->ARR11(3)  <---------DOF5.7(1)
   --------->ARR14(2)<---------KAN1     --------->GATA12       <---------ARR11(3)<---------DOF5.7(1)
   <---------GATA12 --------->ARR11(2)  --------->RVE1(2)      <---------RVE1(2)--------->HSFC1(2)
  <------ZmHOX2a(1) <---------ARR11(2)  --------->ARR11(3)    --------->YAB1<---------ETT(2)<-------
--->DOF5.7(1)   <---------At4g35610     <---------ARR11(3) ---------->DOF2 --------->HSFB2a(2)     <
-->DOF2 <------ZmHOX2a(1)   ---------->DOF2  ================================HOX2a_HOX2a    <-------
 
atggaggatcaggaaacgaagcggataaccaaaaaaccgtcaagatcgatcatcatcagtctcaaagatattcctcctctcgacccttcttctattccct  30319600
                                                             ----------->RAV1(2)
         <-------TEIL                                        --------->At4g35610
         <---------YAB5                                   <---------YAB5
      --------->AHL12(1)                           <---------AHL25(1)
      --------->KAN1                               <---------AHL25(2)
      <---------AHL12(1)                           --------->AHL25(2)
     --------->ICU4                                --------->AHL12(1)
     <---------YAB5                                <---------AHL25(3)
     <---------AHL12(2)   --------->ARR14(2)       <---------AHL20(2)
     --------->AHL12(2)   <---------GLK1(2)        --------->AHL20(1)
 --------->At5g28300      <---------ARR14(2)       <---------AHL12(1)
--------->YAB1           --------->KAN1            --------->AHL20(2)
----------->GT1        --------->YAB1             --------->AHL12(3)
-------->AGL15         --------->TOE2(3)          --------->AHL25(1)
---------->AGL1       <---------ATHB12            <---------AHL25(2)
---------AGL15       ------>MYB83                 --------->AHL25(3)
----------AGL1       -------->P    <----------DOF2--------->AHL20(2)
---------TOE2(3)     ------>MYB46(1)              --------->AHL25(2)                             <--
----------AG    --------->ANAC46  <---------DOF5.7(1)    <---------RVE1(2)      <---------KAN4(2)---
 
ctatggtaaatattcattcactccaaccatattctcttctttctcgctaacaaaaaaattgatcatctgggtttgaaacagagaacaatctctgcgtttt  30319700
                                                        --------->RVE1(2)
                                                        --------->ARR11(3)
                                                        <---------ARR11(3)
                                                       --------->RVE1(1)
                                                     <---------AHL12(3)
                                                     --------->AHL12(2)
                                                     --------->AHL12(3)
                                                     <---------AHL12(2)
                                                    <---------AHL25(3)
                                                    <---------ICU4
                                                    <---------AHL20(2)
                                                   --------->AHL20(2)
              <<<<<<<<<TBF1                        --------->ICU4            <---------WOX13(2)  <--
        --------->YAB5                           --------->YAB1     <---------ANAC58           <----
     <---------At4g35610                      --------->YAB1        <---------ANAC58    --------->MYB46(3)
-------------AGL15                     ----------->GT1 --------->CCA1(1) <-----------HVH21--------->MYB52(1)
------------>AGL15     <---------RVE1(2)      ----------->GT1   <----------DOF2        <<<<<<<<<<<<<
 
ctatttgtagatgattcttcttctgtgatttggctatatcatgggttaatagtaataaatatctcaactttgcttctgtcaattgttagaaaccaatggc  30319800
      --------->YAB1
      <---------ICU4
     <---------YAB1
     <---------YAB5
   --------->YAB1
  <------ZmHOX2a(2)
 <---------ARR11(3)
 --------->RVE1(2)
 --------->ARR11(3)
----NtERF2                 --------->GLK1(2)
-----ANAC46              --------->KAN1
<<<<LFY      --------->ALFIN1                             >>>>>>>>>TBF1             --------->HSFB2a(2)
 
gcaagatcatcataatgtgggaatgcagagattccaagagaagactgacttcaagtttgaagaagaagacaatgccatttcttccttctctaacattcaa  30319900
<- Previous    Next ->

AGI:  At1g80640.1   
Description:  protein kinase family protein. similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT2G25220.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN79180.1); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Tyrosine protein kinase; (InterPro:IPR001245)
Range:  from: 30316558    to: 30319267    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g80650.1   
Description:  RTL1 (RNASE THREE-LIKE PROTEIN 1); double-stranded RNA binding. similar to double-stranded RNA-binding domain (DsRBD)-containing protein [Arabidopsis thaliana] (TAIR:AT4G00420.3); similar to double-stranded RNA-binding domain (DsRBD)-containing protein [Arabidopsis thaliana] (TAIR:AT4G00420.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO67716.1); contains InterPro domain Double-stranded RNA-binding-like; (InterPro:IPR014720); contains InterPro domain Double-stranded RNA binding; (InterPro:IPR001159)
Range:  from: 30319428    to: 30320711    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version