AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                               <---------ARR14(2)
                               --------->ARR14(2)
                               --------->GATA12                        <---------SPL7(1)
                          --------->At4g35610                         <---------ANAC58
                         --------->GLK1(2)                        ----------->HVH21      ------->GAMYB
                  ------>ZmHOX2a(1)                           <----------DOF2        <---------WRKY12
              <---------ARR11(2)                            ------->TEIL             ---------->CDC5
              <---------ARR14(2)                       --------->CCA1(2)             <---------WRKY38(1)
         --------->DOF5.7(1)   <---------RVE1(2)      --------->ARR14(2)          --------->At4g35610
       ---------->DOF2 <---------HSFC1(2)             --------->ARR11(3)         --------->ANAC58
     --------->LBD16   --------->HSFB2a(1)            <---------ARR11(3)  <---------ANAC58
   <---------LBD16--------->HSFB2a(2)               ----------->ARR10 <---------ANAC58--------->MYB52(1)
  --------->MYB52(1)   --------->HSFC1(2)      ----------->GT1<---------DAG2     --------->ANAC58
--------->MYB46(3)<---------HSFB2a(2)<---------ANAC58 <---------RVE1(2)--------->TOE1(2)--------->MYB46(3)
-------TGA1   --------->ARR14(2)     <---------ANAC46 <---------ARR14(2)  <---------ANAC58   <------NtERF2
-------HVH21  --------->ARR11(2)     <---------ANAC58 --------->ARR11(1) --------->SPL7(1)  --------
 
tcactcaccggaaagagtttcctcgaagcatctggatttgtcgtggtgagaggtgaagatatgaactttatgaccgtgcgaggcaagctcaacggccgca  29632500
                           --------->ARR14(2)
                           <---------ARR11(2)
                           <---------ARR14(2)
                          <---------KAN1
                    ----------->RAV1(2)
                  <---------ALFIN1                                                                --
                <---------ATERF1(1)                            <------ZmHOX2a(2)             <------
              --------->At4g35610        <---------ZAT18      <---------GATA12               <------
              <---------At4g35610        ------->GAMYB        --------->GATA12               <------
              <---------ZAT2            --------->ANAC58      --------->AGP1<---------ARR11(3)   <--
     --------->WOX13(1)   <----------TaMYB80    <---------ZAT6<---------ARR11(3)         --------->KAN1
   <---------ATHB12<---------ATERF1(1)  --------->ANAC58      --------->ARR11(3)        <---------YAB5
 --------->WOX13(1)------>NtERF2--------->ANAC46----------->GT1--------->CCA1(2)     --------->KAN1
--------->MYB46(3)--------->DEAR3(1)  --------->MYB52(1)     --------->GLK1(1)<---------ICU4 <------
->RAP2.6(2)   --------->ZAT2   <---------HSFB2a(2)   <---------WOX13(2)     --------->ARR11(3)------
 
tcaacaatcaatctctctgctccgcctgcatataccagaaacaacgcactagtgtaaatttgtgagatccaaacgagaagataatgacttattcatccgt  29632600
                                             --------->KAN1
                                            <---------ARR14(2)
                                            --------->ARR14(2)          --------->TOE1(1)
                                            <---------ARR11(2)          --------->ANAC46
      ---------->DOF2                       --------->ARR11(2)         --------->LBD16
    <---------ATHB12                       --------->DOF5.7(2)         ========================HOX2a_HOX2a
   --------->RVE1(2)                     <---------ANAC58        <---------ICU4
------->RVE1(2)                          <---------ANAC58  <------MYB46(1)              ------>ZmHOX2a(2)
---ANAC58                            --------->WOX13(2)    ----------->GT1 <---------ARR11(2)     --
---ANAC58                      ------>ZmHOX2a(2)  <----------DOF2<-----------GT1      <---------GATA12
---ANAC55(1)            --------->ATHB12 <---------ANAC46  <------MYB83--------->HSFB2a(2)  --------
-------CCA1(2)         <---------YAB5<---------WOX13(2)   --------->MYB59  --------->ARR11(2)   ----
---ANAC46    <-------GAMYB   --------->ARR11(3) --------------->AGL15  ------>ZmHOX2a(1)============
--->LBD16   ----------->GT1  <---------ARR11(3) <---------------AGL15  <---------LBD16--------->GATA12
 
gtatcaaatcaaagtctgttaaactagttattgatctctcaattgcgtttactctttgaagttggtaataactcctcggaaccaagatagatcgcagaag  29632700
                                                                               --------->ARR14(3)
                                                                               <---------GATA12
                                                                               --------->AGP1
                                                                               <---------ARR11(2)
                                                                               --------->ARR11(2)
                                                                               --------->ARR14(2)
                                                                               --------->GATA12
                                                                               <---------ARR14(3)
                                                                               <---------AGP1
                                                                   ------->TEIL<---------ARR14(2)
                                                                 <---------SPL7(1)
                                                               --------------->AtSPL3
                                                               <---------------AtSPL3
                                                               --------------->AtSPL8
                                                               <------ZmHOX2a(2)
          --------->ANAC46                                     <---------------AtSPL8
      --------->YAB1                                          <-----------ARR10--------->ARR11(3)
      --------->KAN1                                          <---------ARR14(2)
     <---------ATHB51        <-----------RAV1(2)              <---------GATA12 <---------ARR11(3)
     <---------ATHB12       <---------YAB5        <---------KAN1------>ZmHOX2a(2) <---------HSFB2a(2)
------->DOF5.7(1)           <---------ATHB12--------->RVE1(2) --------->GATA12 --------->RVE1(2)
->At4g35610        --------->DOF5.7(1)  --------->YAB1        --------->ARR14(2) ------>ZmHOX2a(2)
------>DOF2     <------ZmHOX2a(1)     --------->RVE1(2)       --------->ARR11(3)<------ZmHOX2a(2)
=======================HOX2a_HOX2a   --------->GLK1(1)        <---------ARR11(3)--------->CCA1(2)
 
aaagaccaattatacgagaggaagaaggctaatcagggggaaatcaaaatcgaacaattgatgaagatcgtacctattccaagatctggatgtataatgg  29632800
                        <-----------GT1
                       ---------->ID1                                                              <
                      <-----------GT1                                                              <
                   <---------DOF5.7(1)                                    --------->REM1(2)        -
                  <----------DOF2                                       --------->LBD16            <
             --------->HSFB2a(1)                                 <----------DOF2                   -
             <---------HSFC1(2)                                 <---------ANAC58              XXXXXX
             --------->HSFC1(2)                   <---------ANAC58    <---------LBD16         XXXXXX
            ------->TEIL--------->ANAC46          <---------ANAC58    --------->LBD16         XXXXXX
           <-----------GT1              <---------WRKY18(1)     <---------ANAC58           <--------
  <-------TEIL   <---------DOF5.7(1)   ----------->HVH21    <---------MYB52(1)   *TSS     ----------
 
cgatgttcatctttgaaccttcttttttcgccatttacagacttgactggtttacgttcttctgtttgctttccccgtgaacaatttttagaggtgtcaa  29632900
          ------>NtERF2
         --------->ANAC58
         --------->DEAR3(1)
         --------->ANAC58
         --------->ANAC46
    ----------->HVH21                                                                              -
<---------RVE1(1)                                                                               ----
<---------CCA1(1)                                                                    --------->ARR11(2)
---------ARR11(3)                                                                    ---------->DOF2
---------AHL20(1)                                --------->WOX13(2)               ==================
-------->AHL20(1)                                <---------WOX13(2)               <-----------RAV1(2)
---------RVE1(2)                              --------->AHL20(2)         --------->KAN1       <-----
-------->ARR11(3)                           ----------->GT1         ------------>CBF <---------ARR14(2)
XXXXXXXXXXXXXX>MIR399A                --------->ANAC58             ----------->RAV1(1)--------->GLK1(1)
XXXXXXXXXXXXXX>MIR399D                --------->ANAC58             ===========================RAV  -
XXXXXXXXXXXXXX>MIR399E   <------------CBF  --------->DAG2       --------->PCF2 ------>NtERF2--------
---HVH21--------->MYB46(3)          --------->MYB52(1) <---------KAN1  <------------CBF     --------
->GT1<-----------GT1     <---------GATA12 ---------->DOF2      <-----------TCP11(1)  --------->ARR14(2)
 
aagatatttgacccgcccgtcttggacagattggattaaaaacggaaaagttaatagagtttctcaaggcccacaattgttcggcccagatagcccaaca  29633000
                   <---------ANAC55(2)
                   --------->ANAC55(2)
                   --------->ANAC58
                   --------->ANAC46
            <---------AHL12(2)
          --------->AHL25(3)
         <---------AHL12(2)
         --------->AHL12(2)
       --------->AHL12(3)
       --------->AHL25(3)
       --------->AHL20(2)
       --------->AHL25(2)
       --------->AHL12(1)
       --------->AHL25(1)
       <---------AHL12(1)
       <---------AHL25(3)
       <---------AHL20(2)
       <---------AHL25(1)
      --------->AHL25(1)
      --------->AHL12(1)
      <---------AHL20(2)
      <---------AHL20(1)
      --------->AHL25(3)                --------->AHL12(2)
      <---------AHL12(1)                <---------AHL12(3)
      <---------AHL25(2)                <---------AHL12(2)
      <---------AHL25(1)                --------->AHL12(3)
      --------->AHL25(2)  <---------AHL12(2)
      --------->AHL20(2)  <---------AHL25(3)
      --------->AHL12(3)  <---------AHL20(3)
     --------->AHL12(2)   <---------AHL25(1)
    --------->AHL12(2)    --------->AHL20(3)
    <---------AHL12(2)    --------->AHL12(3)
   --------->AHL20(3)     <---------AHL12(3)
   <---------AHL20(2)    --------->AHL25(1)
   <---------AHL25(3)    --------->AHL25(3)
   --------->AHL25(2)    --------->AHL20(2)                <---------YAB1
   <---------AHL25(2)    <---------AHL25(1)                <---------AHL12(2)
   <---------AHL20(3)    <---------AHL20(2)               <---------AHL20(3)
   <---------AHL25(1)   --------->AHL20(2)                --------->AHL20(3)
   --------->AHL20(2)   --------->AHL20(3)                --------->AHL12(2)
   --------->AHL25(1)   <---------AHL20(3)                <---------AHL20(1)
  <---------AHL20(2)    --------->AHL25(3)                --------->AHL25(2)
  --------->AHL20(2)    --------->AHL25(1)--------->KAN1  <---------AHL25(2)
  --------->AHL25(3)    <---------AHL12(3)<---------AHL20(2)
  <---------AHL25(1)   <---------WOX13(2) <---------AHL25(3)     <---------------AGL15         -----
  --------->AHL25(1)   --------->WOX13(2)--------->AHL25(3)--------->AHL12(2)                  <----
-------->YAB5      --------->ANAC58    --------->AHL12(2)<---------ICU4                      <------
------->GT1<---------AHL25(3)         <---------AHL12(1)--------->ICU4                       -------
====RAV<---------AHL12(3)<---------AHL25(3)       <---------ANAC58                           <------
------RAV1(2)  --------->RVE1(2)      --------->AHL12(1)<---------YAB1             <---------GLK1(1)
---------->GT1 --------->ARR11(3)     <---------KAN1 <-------TEIL--------------->AGL15       -------
->MYB52(1)--------->AHL20(2)  <---------YAB1      <---------ANAC58           --------->ICU4 --------
--->RAV1(1)<---------AHL20(2)--------->RVE1(2)    <---------ANAC46    ---------->DOF2  <---------ANAC46
 
ggtgattaaattatttaatatcacgaaattaatatcactgaatatttattctgacgttcattatttttctctgaaaagaaatgttgaattctgtatattt  29633100
     --------->MYB46(3)
     <---------KAN1   --------->AHL20(1)
  <----------ID1      --------->AHL25(2)
---->YAB1             <---------AHL25(3)
-----AHL20(2)        <---------AHL25(1)        --------->KAN1
---AHL12(3)          --------->AHL20(2)      ----------->RAV1(1)
-->AHL20(3)          <---------AHL12(3)   --------->AtLEC2                  <---------RVE1(2)
---AHL20(3)         --------->AHL12(2)  <---------ANAC58                <----------DOF2     <-------
-->AHL12(3)      --------->AHL20(2)     <---------ANAC46          ----------->GT1  --------->KAN1
->AHL12(2)--------->YAB5 <---------YAB1 <---------ANAC58   ---------->DOF2 --------->ATHB12---------
 
ataagggaacaaatgtttatgtaaatatatgatttagtctgtgtcttgcaacattctatctccaaagtatggaaactttgatttgaatactccaaaattc  29633200
                        <---------WOX13(2)
                        --------->WOX13(2)
                  --------->AHL25(2)
                  --------->AHL12(3)
                  <---------AHL12(2)
                  <---------AHL12(3)
                 --------->AHL25(2)
                 <---------ARR11(3)
                 <---------AHL25(2)
                 --------->ARR11(3)
                 <---------AHL12(1)
                 --------->AHL12(2)                    --------->ZAT18
                 --------->AHL20(3)                    --------->ZAT14
                 --------->AHL20(1)                    <---------ZAT14
                 <---------AHL20(3)                    <---------ZAT18
                 <---------AHL20(1)                 <---------ANAC58           --------->YAB5
                 --------->AHL12(1)                 <---------ANAC58   <---------YAB5
                <---------KAN1--------->YAB1        <---------ANAC46   <---------YAB1
                <---------AHL12(1)                 <---------------AtSPL8   --------->YAB5
                --------->AHL12(1)                 --------------->AtSPL8   --------->YAB1
       --------->DOF5.7(1)   <---------ATHB12---------->DOF2     <---------RVE1(2)
--GLK1(2)     <---------GLK1(2)            --------->YAB1       --------->ANAC55(2)            <----
>KAN1---------->DOF2   <-----------GT1   --------->RVE1(2)      <---------ANAC55(2)            <----
 
tcagtgagaaaagaacagaatatttttaactaatcaaaattcagaatcaaaagttgagtacactaatacatattgtcattgatgactccattaccaagtc  29633300
                                                  <---------ZAT18
                                               <---------ANAC58
                                           <---------ARR11(3)       <----------DOF2
                                           --------->ARR11(3) --------->ANAC46
                                    ----------->RAV1(2)       --------->ANAC55(2)                  -
       --------->YAB1        --------->YAB1--------->GATA12  <-------TEIL                        <--
-----ANAC58                 <---------AHL20(2) <---------ANAC58<---------MYB59                   ---
-----ANAC58             --------->AHL20(2) <---------GATA12<---------ARR11(2)        <----------DOF2
 
gtgagaagtttgataacatgccgaaaactaaataatagtacctgaagatttagtgccttccatatacataactttgtgcctcttgagtctttgactcttc  29633400
<- Previous    Next ->

AGI:  At1g78800.1   
Description:  glycosyl transferase family 1 protein. similar to SUS5, UDP-glycosyltransferase/ sucrose synthase [Arabidopsis thaliana] (TAIR:AT5G37180.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39410.1); contains InterPro domain Glycosyl transferase, group 1; (InterPro:IPR001296)
Range:  from: 29630552    to: 29632882    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g78810.1   
Description:  similar to hypothetical protein [Vitis vinifera] (GB:CAN60296.1)
Range:  from: 29633162    to: 29635446    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version