AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                --------->YAB1
                              <---------AHL20(3)
                              --------->AHL20(3)
                              <---------AHL12(2)
                              --------->AHL25(2)
                              <---------AHL12(3)
                              <---------AHL25(2)
                             --------->AHL12(2)
                             <---------AHL12(2)
                            <---------AHL20(2)
                            --------->AHL20(2)
                            <---------AHL12(1)                                           <---------GATA12
                            --------->AHL12(1)                                      --------->ANAC55(2)
                            <---------AHL20(3)                                      --------->ANAC58
                            <---------AHL25(1)                                      <---------ANAC46
                            --------->AHL25(3)                                      <---------ANAC55(2)
                            --------->AHL20(3)                                      <---------HSFB2a(2)
                            <---------AHL25(2)                                      --------->ANAC58
                            --------->AHL25(2)                                     <---------LBD16
                            --------->AHL25(1)                                   <---------ARR11(2)
                          --------->AHL12(2)                                     <---------ARR14(2)
                    --------->AHL25(1)                                           --------->ARR11(2)
                    --------->AHL20(2)                                           --------->ARR14(2)
                    <---------AHL20(3)                                         <---------MYB46(3)
        <--------ATHB1    <---------AHL12(2)                                <---------ANAC58
        --------->YAB1   <---------AHL25(3)                                 <---------ANAC46
   --------->AHL20(2) <---------AHL12(2)                  ----------->GT1   <---------ANAC58      <-
------>GT1          --------->AHL20(3)  <-----------HVH21--------->ALFIN1 --------->MYB52(1)    ----
----->GT1       --------->AtMYB61  <-----------GT1<---------KAN1    --------->TOE1(3)   --------->GLK1(1)
-->DAG2<---------ATHB51  --------->AHL20(2)   --------->ANAC58      --------->TOE2(3)--------->LBD16
-->DOF2<---------ATHB12 --------->AHL20(2)    --------->ANAC58<---------KAN1<---------bZIP60(2)<----
 
ttaaaattcaataataccaccaaaaaaataaaaaattataacgagtcacaagaattagaggtggaataaaacctgaataacgtggttacggaaatcgaat  29207800
       <----------DOF2                  --------->YAB1                                            --
      <---------DOF5.7(1)     ---------->DOF2  --------->CCA1(2)                                 ---
----------GT1              --------->ANAC46   <---------RVE1(2)                                  <--
----->AHL12(1)      --------->KAN1 --------->ZAT18                          ---------->DOF2      ---
-----KAN1          <---------RVE1(2)--------->ZAT6                      --------->TOE2(3)       <---
 
ttttctcgttctttacgagttcgatattcaacgtaaagaacactaatgagataagcagtccaacttcccattaatccataaaagagttgaaacaaaattc  29207900
                                                                --------->YAB1
                                                               <---------YAB1
                                                              --------->AHL20(2)
                                                              <---------AHL20(3)
                                                              --------->AHL20(3)
                                                        ------>MYB83
                                                        ------>MYB46(1)
                                                      <-------PIF5
                                                      ------->PIF5
                                                      <---------MYB55(2)
                                                      --------->MYB46(3)
                                                      <---------MYB111(1)
                                                     --------->At4g35610
                                                     ----------->RAV1(2)
<---------bZIP60(1)                                  <---------At4g35610
--------->bZIP60(1)                                  <---------ZAT2
---->NtERF2                           --------->At4g35610    <---------DOF5.7(1)
------>ANAC46               --------->YAB1--------->ARR11(3)--------->ICU4                     <----
-------ETT(1)               ----------->GT1        <---------ALFIN1                        <-------TEIL
------>LBD16             <---------KAN1 ------->GAMYB--------->ZAT2<-----------GT1       <---------ARR11(2)
------HSFB2a(2)       --------->YAB5--------->ETT(2)------>NtERF2  --------->YAB1     <-------------
 
ccgacatcatcccaagttgtgagaacgagtatggtaatgtcaacagaacttgtgccacctgccatttttataacaatttagctatagaagacgatacata  29208000
                                                                          --------->ARR14(2)
                                                                          <---------ARR14(2)
                                                                          --------->ARR11(2)
                                                                    --------->ETT(2) <---------HSFB2a(2)
                              <-------TEIL                    --------->YAB1      --------->ANAC58
                          --------------->AtSPL3             <---------ATHB12     --------->ANAC58
                    <-----------RAV1(1)                     --------->ANAC58      --------->AtLEC2
                 --------->GATA12   <---------MYB59         --------->ANAC58    <---------ALFIN1
---TEIL    --------->ZAT6 <---------------AtSPL8            ------>MYB46(1) --------->MYB46(3)
--------WRI1     <---------GATA12 --------->MYB52(1)        ------>MYB83  <---------ARR11(2)
 
cacatctatatataagactaaatctgtgggaagtacatacctgatttgaagcacaactaaaccaagcatcgtagacagaaccaccatgccagaagaaatt  29208100
                            <-----------GT1                                     <---------ALFIN1
                       <---------ANAC58                                         --------->AtMYB61
                       <---------ANAC58                                        --------->MYB46(3)
                    <---------GLK1(1)                                         >>>>>>>>>>>>>>>>>LFY
                    --------->GLK1(1)                                       ----------->HVH21      -
                   --------->ARR11(3)                                   <---------ANAC58           -
                   <---------ARR11(3)                                   <---------ANAC58           <
            <---------WOX13(2)                                          ----------->RAV1(2)        <
            --------->WOX13(2)               <<<<<<<<<TBF1         --------->KAN1            <------
 
agagagttttgttttagttgaagatttcttgttaccacttatgttttcttcttccctctccatttctaagtaattccctgcgaccactgtctctattttc  29208200
                                                                                       --------->AHL20(2)
       <---------DOF5.7(1)                                                             <---------AHL25(3)
   <------NtERF2                                                                       <---------AHL25(1)
  <---------RAP2.6(3)                                                                  --------->AHL25(1)
  ------>NtERF2                                                                        <---------AHL20(2)
 --------->RAP2.6(2)                                                                  <---------AHL20(2)
 --------->RAP2.3(3)                                                                  --------->AHL25(3)
 --------->ATERF1(2)                                                                 --------->AHL12(2)
 --------->RAP2.3(2)                                                                --------->AHL12(2)
 --------->DEAR3(1)                                                                --------->AHL25(1)
 <---------ATERF1(2)                                                               --------->AHL20(2)
 --------->ANAC46                                     ----------->TBP              <---------AHL25(1)
--------->RAP2.3(1)                                 <----------DOF2  ---------->DOF2<---------AHL12(2)
-------->At4g35610                                 <---------DOF5.7(1)             <---------AHL20(2)
----->NtERF2                           <----------DOF2<---------AHL20(2)  <----------DOF2
---------At4g35610                <---------At4g35610 --------->AHL20(2)  <---------DAG2      <-----
---------ATERF1(1)               *TSS <---------DOF5.7(1)         <---------ZAT6  --------->AHL25(3)
-----GT1 <-----------GT1      <----------DOF2  <---------ALFIN1 ----------->GT1   --------->AHL20(2)
 
tctgccgccatttttctcttcttctctcagtttctttagcttctttacttccactctttaaatagactagtgaaaagctttttcatttatttatttgttt  29208300
                                                       <---------SPL7(1)
                                                       ----------->HVH21
                                                     <------NtERF2
                                  <--------ATHB1    <---------LBD16
                                  --------->ATHB51 --------->ETT(1)
                                  -------->ATHB1   <---------ANAC58
                                  <---------ICU4   <---------ANAC46
                                  --------->ATHB12 <---------LBD16                              <---
                                 --------->ICU4    <---------ANAC58                             <---
                                 <---------YAB5 <---------KAN1                         <---------YAB5
                                 <---------ATHB12 --------->ALFIN1           ----------->HVH21  ----
                                 <---------ATHB51<-----------HVH21         <---------ZAT2      <----
                              ------------>ATHB5--------->ALFIN1           <---------At4g35610 <----
                <----------DOF2  <---------YAB1 <-----------RAV1(1)        --------->At4g35610 -----
        <-----------GT1 <---------ANAC46  --------->MYB52(1)               --------->ZAT2      <----
-----DOF2   <----------DOF2  ------------>CBF   ----------->HVH21<----------DOF2      <-----------HVH21
 
tatgggttttgtttcctttcttttgctctgtgtgcaattattgagtaacgagtgtcgggggacgaagtctttagtcacagctcacgagttgtcatgggga  29208400
                 ----------->HVH21
               <------MYB46(1)
               <------MYB83
               ----------------------->TaNAC69(2)
               <---------MYB46(3)
              <---------MYB46(3)
              --------->MYB46(2)
              --------->MYB55(2)
              <---------DEAR3(1)
            <---------ANAC58
           <------MYB83
           --------->MYB55(2)            ----------->HVH21
           <---------MYB46(3)       ------>MYB83
           <------MYB46(1)          ------>MYB46(1)
         <---------WOX13(1)         -------->P                                                    <-
       --------->ATHB12      <-----------HVH21                                 <---------AHL20(2)<--
      <---------YAB1        <---------TGA2(1)                         <-------GAMYB             >>>>
      <---------YAB5        --------->TGA2(1)                        <---------ANAC58           <---
------GLK1(1) --------->MYB111(2) <---------MYB111(2)                <---------ANAC46         <-----
------KAN1 --------->ATHB12 --------->bZIP60(1)                      <---------ANAC58     --------->ATHB12
----->GLK1(1) --------->MYB111(1) <---------MYB111(1)             --------->ALFIN1      <----------DOF2
-----RVE1(2)<---------ANAC58<---------bZIP60(1)                 --------->ALFIN1       <---------ANAC58
-----ARR14(2) <---------AtMYB61   <---------MYB46(2)            <---------ANAC58       <---------ANAC58
---->ARR14(2)<---------MYB55(1)<-----------GT1   <---------At5g28300<------NtERF2 --------->WOX13(2)
-----ARR11(2)<--------P    --------->MYB59    <-------GAMYB     <---------ANAC58<---------AHL20(2)<-
 
tatcggtttatgattggttggtgactgagttatgtcacctacttgtgactgttactgttttcggcgagcgtggcgttgtttttttaatgggcttgatttg  29208500
                                                                     <---------RVE1(2)
                                                                     --------->ARR11(3)
                                                                     --------->AHL20(1)
                                                                     <---------AHL20(1)
                                                                    --------->AHL12(2)
                                                                    <---------AHL12(2)
                                                                   <---------AHL25(3)
                                                                  --------->AHL25(1)
                                                                  <---------AHL25(1)
                                                                  --------->YAB1
                                                                  <---------AHL20(2)
                                                                  --------->AHL20(2)
                                                                  <---------AHL12(1)
                                                <------NtERF2     --------->AHL12(3)
                                               <---------LBD16    --------->AHL20(3)
                                             <---------PCF2       <---------AHL12(3)
                                            <------MYB83          <---------AHL20(3)
                                            <------MYB46(1)       --------->AHL12(1)
                                           --------->MYB59       <---------YAB5
      <----------DOF2             --------->ANAC58              --------->WOX13(2)
----------RAV1(1)                 --------->ANAC46              --------->AHL12(2)
-------WOX13(1)                   --------->ANAC58              <---------AHL12(2)              ----
>>>>>ARR2                       ----------------->AGL1          <---------WOX13(2)             -----
------RVE1(2)         <---------HSFB2a(2) <--------P   <---------TOE2(3)           --------->YAB1
----YAB1              --------->HSFB2a(2)<---------MYB52(1)----------->GT1     --------->LBD16------
--------MYB46(3)     <---------LBD16--------->MYB52(1) <---------RVE1(2)    -------->ZAP1     ------
 
attgttgggcttatgggccatatttctggagcattacacgaacgggtaggcccggtttgagattgttaattatatattgaccccgataatatgcaaaaaa  29208600
                      <---------TOE1(3)
                      <---------TOE2(3)
           --------->AHL20(2)
           -------->HAHB4
           --------->YAB1
          <---------YAB5
          <---------YAB1
         <---------WOX13(2)
       <---------------AGL15
       --------------->AGL15
     --------->At4g35610
     <---------At4g35610     <---------TOE2(3)
  <--------P         ---------->DOF2                   --------->WOX13(2)
 <-------GAMYB  <---------RVE1(2)                      <---------WOX13(2)             --------->AHL12(2)
----->DOF5.7(1) <---------GATA12          <---------ZAT14                      --------->YAB1
---->DOF5.7(1)  <---------ARR11(3)        --------->ZAT18----------->GT1      --------->ICU4
---->DOF2--------->WOX13(2) ---------->DOF2       ----------->GT1             <---------ATHB12
--->DOF5.7(1)   --------->ARR11(3) <---------ZAT6 --------->YAB1         --------->YAB5         ----
 
agagggttagctaattatagattttaaagtttaaagtagtgagagtagactaattgtaaattgaaaatagaagtgatgacaatgatgttttttttttttg  29208700
<- Previous    Next ->

AGI:  At1g77690.1   
Description:  amino acid permease, putative. Identical to Auxin transporter-like protein 3 (LAX3) [Arabidopsis Thaliana] (GB:Q9CA25); similar to amino acid permease, putative [Arabidopsis thaliana] (TAIR:AT2G21050.1); similar to amino acid permease, putative [Arabidopsis thaliana] (TAIR:AT5G01240.1); similar to AUX1 (AUXIN RESISTANT 1), amino acid transmembrane transporter/ transporter [Arabidopsis thaliana] (TAIR:AT2G38120.1); similar to auxin influx transport protein [Casuarina glauca] (GB:ABN81351.1); similar to auxin influx transport protein [Casuarina glauca] (GB:ABN81352.1); similar to Auxin transporter-like protein 3 (AUX1-like protein 3) (MtLAX3)
Range:  from: 29205835    to: 29208234    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version