AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                  <-------TEIL                          <---------ANAC58             --------->GLK1(2)
                --------->ARR14(2)                      <---------ANAC46             --------->RVE1(2)
                <---------ARR14(2)                     <-------TEIL                  --------->ARR14(2)
          --------->LBD16                           <---------At4g35610              <---------ARR14(2)
          ------>NtERF2 ------>ZmHOX2a(1)      <----------DOF2      --------->DOF5.7(1)  <---------DOF5.7(1)
         --------->ANAC58                   <---------ALFIN1      ---------->DOF2    <---------ARR11(2)
         --------->ANAC58              --------->RVE1(2)<---------ANAC58  <------ZmHOX2a(1) <-------
---------YAB1  --------->KAN1   <----------ID1 <---------DAG2 ---------->DOF2       <---------GLK1(2)
ttatgttatgtcccgcccaaattcgtcctacaaaaacaccaaaatcaacacttttagcttcgtgagaaagaaagcgaggaagagagagaatcccttaccg  27967200
       --------------------->WRI1                      <-----------HVH21  --------->O2
    <-----------HVH21                    --------->ZAT18     --------->ANAC58                      <
   <---------KAN1                        <---------ZAT14    --------->LBD16            <------------
------>REM1(2)                           --------->ZAT14   <---------ANAC46     <----------DOF2    <
----ANAC46 --------->ARR11(3)        ------->TEIL <---------GLK1(1)   <---------RAP2.6(3)    <------
--At5g28300<---------ARR11(3)     <---------KAN1  --------->GLK1(1)  --------->RAP2.6(2) <---------ZAT14
tgaagaatgtcatagaccttatcggcgatttcagagaatgtatgtgcagagagaactccgtcgcgcgtaatgccgctacgtcgctttgtgagcgtagaga  27967300
 <------ZmHOX2a(1)             <---------KAN1
 =============HOX2a_HOX2a  --------->ZAT18                                       --------->RVE1(2)
---------TOE1(3)      ---------->DOF2    <---------At4g35610                   <---------ALFIN1
---------WRI1<------MYB46(1) ----------->GT1       <-----------------AG      <---------ALFIN1   ----
---------TOE2(3)    --------->MYB46(3)   <---------GLK1(1)                  <------NtERF2       ----
---YAB5<------ZmHOX2a(2)  --------->ALFIN1    ------>ZmHOX2a(1) <---------WOX13(2)            ------
ttaaggaaagatcagtaggtcgaaccaaagtggagtaactatagagctcctctagcctccttgggcaaactaagatggccccaaactccaaaatcgcgaa  27967400
                   <------------AtMYB77                                      --------->ANAC58
                   --------->DEAR3(2)                                        --------->ANAC46
                   --------->MYB46(3)                             <------NtERF2
                  <---------ATERF1(1)                            ------>NtERF2
                 --------->ARR11(2)                              --------->ABI4(1)
                 <---------ARR11(2)                             --------->RAP2.3(2)
                 --------->ARR14(2)                             --------->RAP2.6(2)
                 <---------ARR14(2)                             --------->RAP2.3(3)
              --------->ETT(1)                                  --------->DEAR3(1)
           <------MYB46(1)                                      <---------ATERF1(2)
           <------MYB83--------->RAP2.3(2)                      --------->ATERF1(2)
       <---------RVE1(2)------>NtERF2                          --------->RAP2.3(1)
      --------->ATHB12--------->DEAR4(2)                       --------->DEAR4(2)
   <-----------------AGL1                --------->ANAC46      --------->ERF1--------->ANAC58
   ----------->RAV1(2)--------->RAP2.3(1)--------->ANAC58      --------->ORA47(2)
----->DAG2--------->MYB59                --------->ANAC58      --------->ATERF1(1)         ---------
----->DOF5.7(1)<---------DEAR3(2)     --------->DOF5.7(1)     <---------ATERF1(1)         --------->DAG2
---->DOF2 <---------AtMYB61       ----------->GT1            --------->DEAR3(1)          ---------->DOF2
aggctcccctgatttggtcggaaccgccgtctcaaggtcgaaaaacgctatctcgcttctctcatcgccgcccagactcgaagccattgttgaaaagtga  27967500
                                                           --------->ANAC58     <---------ARR11(3)
                                                          ------>NtERF2         --------->RVE1(2)
                                                        <------NtERF2           <---------GATA12
                                                       <-----------HVH21        --------->GLK1(2)
                                                       ------>NtERF2            --------->ARR11(3)
                                                      --------->ANAC58   --------->LBD16
                                                      --------->ANAC58  --------->ANAC55(2)
                                                      --------->ANAC46  --------->ANAC46
                                                    --------->ANAC58    <---------ANAC55(2)      ---
                                                    --------->ANAC46   <---------LBD16           ---
                                   ==================================bZIP_DOF  --------->RVE1(1) ---
                             <------MYB83 <---------KAN4(2)--------->bZIP60(2)--------->AHL12(1) ---
                 --------->GLK1(2) ---------->DOF2  --------->ANAC58  <-----------GT1            <--
        --------->DOF5.7(1)  <------MYB46(1)  --------->At4g35610 --------------->AGL15          ---
       *TSS  <------ZmHOX2a(1)  <-----------TBP <-----------HVH21<---------DOF5.7(1)           -----
-->GT1---------->DOF2      --------->ALFIN1<---------KAN1<---------ALFIN1----------->GT1<----------DOF2
aaactgatagaaagaaggagaagctaataggtgggttttaaagcgaatgagcttcacgcgccacgtcctctttttacggaaaaaatctaaactttgagag  27967600
                         <-----------TGA1                                                         <-
                         <-----------HVH21                                                        --
                        <---------ANAC58                                                          --
------>ANAC46           <---------ANAC58                                                ------>MYB83
------>ANAC58           <---------ANAC46                                                ------>MYB46(1)
------>ANAC55(1)    <---------ANAC58                                                  --------->AtMYB61
------>ANAC58----------->GT1 --------->At4g35610                                     --------->ANAC46
-------ANAC55(2)    <---------ANAC58                                                 --------->ANAC58
------>ANAC55(2)  --------->ARR11(3)          <---------YAB5                         --------->ANAC58
---->CCA1(2)<---------TOE2(3)<---------At4g35610                  <----------DOF2  --------->ANAC46
acgcaactgtagaatgaggtttatcttgcgtcatctgcattcacttggagtgatcaacaaatttgattcctttcttctacattttcacaccaaatcgctt  27967700
                                    --------->ARR11(2)           --------->DEAR3(1)
                                    <---------ARR11(2)         --------->LBD16
                            ------->TEIL                       ------>NtERF2
                            --------->ARR14(2)                --------->HSFB2a(2)
                     --------->ARR14(2)                       --------->ANAC46
                     <---------ARR14(2)                       <---------HSFB2a(2)
                     <---------ARR11(3)    --------->YAB1     <---------ETT(1)
                     <---------AHL20(1)   <---------ATHB12    <---------ATERF1(2)
                     --------->AHL20(1)  ------>MYB83    --------->GATA12
                     <---------ARR14(3)  --------->RVE1(2)<---------GLK1(1)
          <----------DOF2   <---------GATA12       <----------DOF2
       <---------ALFIN1     --------->GATA12---------->DOF2  <---------LBD16
     ------->GAMYB   --------->RVE1(2)--------->MYB46(3) <---------RVE1(2)
    --------->MYB46(3)      <---------ARR14(2)    <---------DOF5.7(1)
  <-----------GT1    --------->ARR11(3)  ------>MYB46(1) <---------GATA12                     ------
--------GATA12       --------->ARR14(3) --------->WOX13(1)--------->GLK1(1)   ---------->DOF2 ------
------->GATA12 --------->ANAC58 --------->LBD16 <---------ARR11(3) <------NtERF2      <---------TOE1(2)
------->RVE1(2)--------->ANAC58 <---------LBD16 --------->ARR11(3)------>NtERF2      ------>ZmHOX2a(1)
aaatctaaccacactttgaagcaatatcttgaatctggggaaccaatcaaagctcttttagatttccggcaccgattcagacaaagtcctagttttgttg  27967800
                                           <---------HSFB2a(1)     --------->ARR14(2)
                                           --------->HSFB2a(1)     --------->GATA12
                                           --------->HSFC1(2)      <---------ARR11(3)
                                  <---------ZAT2                   <---------ARR14(2)
                                  --------->At4g35610              <---------GATA12
                                  --------->ZAT2                   <---------ARR11(2)
                                  <---------At4g35610              --------->ARR11(3)
                               <---------MYB52(1)                  <-----------ARR10
                              <-----------HVH21                    --------->ARR11(2)
                              <-----------TGA1                     --------->AGP1
                       <---------TOE2(3)   <---------HSFC1(2)--------->ETT(2)
        <---------MYB52(1)   <---------ANAC46       --------->ANAC55(2) --------->ANAC46
   <-----------GT1    ---------->DOF2   ---------->DOF2      <---------ETT(2)
----->HVH21  <---------ANAC58<---------ANAC58    ------>ZmHOX2a(1)--------->At4g35610
--->ETT(2)   <---------ANAC58<---------ANAC58    ==========================HOX2a_HOX2a
acagtttttctgttttgtttgccattaaagtttcgtcagctcagaaagcttcctcacttgatggtagacagatccacgctcttgtaagaaaactaggttt  27967900
                                              --------->ALFIN1                         ----------->RAV1(2)
                                             --------->LBD16                         --------->ANAC58
                                    <-----------GT1               --------->ANAC46   --------->ANAC58
     --------->KAN1             <---------RVE1(2)    <---------bZIP60(1)        --------->ANAC58
    <---------MYB52(1) <----------DOF2       <---------LBD16      --------->ANAC58--------->ARR11(2)
   <---------RAP2.6(3)<---------DOF5.7(1)   <---------ANAC46      --------->ANAC58<---------ARR11(2)
   <-------GAMYB    --------->ARR11(3)      <---------ANAC58     ------->TEIL   --------->ANAC46
  ----------->GT1   <---------ARR11(3)      <---------ANAC58<---------KAN1      --------->ANAC58
caatgccgttattcaaattcaaacatctttagtgggattctactcttccgtgggtgatgtcgattatgcacgccaagtgttcgacgaaacgcctgagaaa  27968000
                      --------->ATHB12                                                         <----
                      --------->YAB5                                                           -----
                     --------->ICU4                                                            -----
                     <---------YAB1         --------->YAB5                                     <----
            --------->ETT(2)                --------->YAB1                                     -----
            --------->ZAT18       --------->ZAT6                                             -------
         <---------ANAC46    <---------At4g35610                     ----------->GT1       ---------
       <---------ANAC58      --------->ZAT2<---------KAN1          --------->At4g35610<---------At4g35610
       <---------ANAC58      --------->At4g35610<---------GLK1(1)  <---------At4g35610--------->At4g35610
cagaacattgtcttgtggacagcgatgatttcagcttacactgagaatgagaactctgtggaagctattgagctgtttaaacgaatggaagcggaaaaga  27968100
<- Previous    Next ->

AGI:  At1g74390.1   
Description:  exonuclease family protein. similar to exonuclease family protein [Arabidopsis thaliana] (TAIR:AT5G07710.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN66660.1); contains InterPro domain Polynucleotidyl transferase, Ribonuclease H fold; (InterPro:IPR012337); contains InterPro domain Exonuclease; (InterPro:IPR006055); contains InterPro domain Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520)
Range:  from: 27965198    to: 27967508    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g74400.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G21065.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64521.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 27967614    to: 27969002    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version