AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                     --------->ARR11(2)
                 <---------YAB1
                <-----------GT1
               --------->YAB1
              <---------YAB1
             <---------AHL12(2)
             --------->AHL20(3)
             --------->AHL12(2)
             <---------AHL25(2)
             --------->AHL25(2)
            <--------HAHB4
            <---------ICU4
            -------->HAHB4
            <---------AHL20(2)
            --------->AHL12(1)
            --------->ATHB51
            -------->ATHB1
            --------->YAB1
            <---------AHL25(3)
           <---------YAB5
           --------->AHL25(3)
           <---------ATHB51
           --------->ICU4
           <---------YAB1
          <---------AHL12(3)
          --------->AHL12(2)
          <---------AHL12(2)
          --------->AHL12(3)
          <---------AHL25(2)
          --------->AHL25(2)
         <---------ICU4
         --------->YAB5                                                                    ------>ZmHOX2a(1)
         <--------HAHB4                                                                    =========
         --------->YAB1              --------->ZAT6                                        =========
        --------->AHL12(1)          --------->ZAT18       ----------->GT1                <---------ANAC58
        --------->ICU4              <---------ZAT18       <---------MYB46(3)             <---------ANAC58
        <---------KAN1              --------->ZAT14    <------MYB46(1)                ==============
        --------->AHL20(2)          <---------ZAT14    <------MYB83                   ==============
        <---------AHL12(1)      --------------->AtSPL8 <---------MYB46(3)             ------>ZmHOX2a(1)
        --------->AHL25(3)   <---------RVE1(2)     <-----------RAV1(1)                <----------DOF2
      --------->YAB1 <---------ARR11(2)     <-----------GT1          -------->P   --------->RVE1(2)
---------YAB1<---------AHL20(3) <---------------AtSPL8<---------AtMYB61           <---------ARR11(3)
 
acatgataagaataattattatcagttccatcgatattgtacactaaaaaccatatgttggtggtgaaaacttaccaagtttcaaaatcctttcctgcta  27424000
                <---------At4g35610
             ----------->ARR10
          <-----------HVH21                                                                        -
      ------>ZmHOX2a(2)                                                                            <
     <------ZmHOX2a(2)                                                                            --
    <---------ARR14(2)                                                                            <-
    --------->GATA12                                                                              --
    <---------GATA12                                                                              <-
    --------->ARR14(2)                                                                            <-
    <---------ARR11(2)                                                                            <-
    --------->ARR11(2)                                                                            --
============HOX2a_HOX2a                                                                           ==
=============HOX2a_HOX2a                  --------->MYB59         <-----------HVH21               --
=============HOX2a_HOX2a           <-----------------AGL1      <---------ANAC58          --------->At4g35610
============HOX2a_HOX2a         ----------->HVH21              <---------ANAC58          <---------At4g35610
 
aactggcgatctgggtgagagcttctctccaagttgtgaccttgttaggcattttagagtcttggtacttgtcaaatgtgaaactcccagtctgatgtct  27424100
         <------ZmHOX2a(2)                                                  <---------At4g35610
        --------->RVE1(2)                                              <---------LBD16
       <------ZmHOX2a(1)                                     <-------TEIL--------->LBD16
------>MYC3                                                 <------ZmHOX2a(2)
-------MYC3                                                <---------ARR14(2)               --------
------->O2                                                 --------->GATA12 <---------ZAT2  ------>MYB83
--------O2                                                 <---------ARR11(2)               ------>MYB46(1)
------->ANAC55(2)                               <----------DOF2       --------->AtLEC2    --------->MYB46(3)
--------ANAC55(2)                          --------->KAN1  --------->ARR14(2)         --------->MYB46(3)
--------ANAC46                           --------->YAB1    --------->ARR11(3)        --------->ANAC58
--------TGA1a                            --------->TOE2(3) --------->RVE1(2)--------->ZAT2<---------MYB111(1)
------->TGA1a                      --------->TOE2(3)       <---------GATA12 --------->GLK1(1)     <-
==============================================bZIP_DOF     <---------ARR11(3)        --------->ANAC58
------->ANAC46                     <----------DOF2         --------->ARR11(2)        --------->ANAC46
 
cacgtgagaaggatcaactccatagaaaatggggacaactttaatcttattctttaggtgaagatccattaccatgcggagctcgtccaagcaccaacta  27424200
                                                                                    <---------ZAT2
                                                                                    --------->At4g35610
                                                                                    --------->ZAT2
                                                                                  ------>NtERF2
                                                                                 --------->DEAR3(1)
                                                                                <------NtERF2
                                                                              --------->DEAR3(1)
                                                       <---------At4g35610    <---------DEAR3(1)  <-
                                                       <---------ZAT2<---------RVE1(2)      <-------
                                <---------KAN1         --------->At4g35610  <---------ATERF1(1)  <--
>P                    --------->YAB1          <---------AtLEC2   <---------LBD16--------->ATERF1(1)-
--------REM1(1)       --------->YAB5        <---------YAB1  --------->GLK1(1)--------->ATERF1(1)<---
 
gatgaagcgtagttctccgatagaatcacaagagcatatgtagagttttgaatggctctgctgatttcttcggagatggagtcgccgagctcaagctttt  27424300
                                                                                  <---------GLK1(2)
                                                                               --------->LBD16
         --------->ANAC58                                                <---------At4g35610
         ----------->GT1                                         --------->LBD16  <---------ARR11(2)
         --------->ANAC46                                       <---------ANAC58  <---------ARR14(2)
         --------->ANAC58                                       <---------ANAC46  --------->ARR11(2)
 <---------YAB1                                   ----------->HVH21      --------->At4g35610
--------YAB5                                     <---------WOX13(1) <---------KAN1--------->ARR14(2)
---DOF2 ------->TEIL <---------DAG2 <---------ANAC58            <---------ANAC58--------->LBD16
---------GT1         <---------DOF5.7(1)       --------->YAB5  <---------LBD16 --------->ANAC46
-------->YAB1     ------->GAMYB     <---------ANAC46        <---------ANAC58  --------->LBD16     --
--------GT1   --------->MYB46(3)    <---------ANAC58        <---------ANAC58  <---------LBD16     --
 
tatcatctttgaacgtaacaactcccttatcgacaagttgtttgtgcaaatgactgacaatgttcttgcgggtgtcttctccccggaaactcaagaacac  27424400
             <------ZmHOX2a(1)
          --------->CCA1(2)
         --------->ARR11(2)
         <---------ARR11(2)                           ===========================HOX2a_HOX2a
         <---------ARR14(2)                           <------ZmHOX2a(2)
         --------->ARR14(2)                           ==============================HOX2a_HOX2a
      --------->HSFB2a(2)                   --------------->AGL15
      <---------HSFB2a(2)    --------->ANAC58 <----------DOF2                           --------->YAB1
 --------->SPL7(1)           --------->ANAC58<---------DOF5.7(1)             <------ZmHOX2a(1)   ---
------->TOE1(1)           <---------REM1(1)<-----------------AGL3         <------ZmHOX2a(1)---------
------->TOE2(1)--------->At4g35610<---------MYB52(1) <---------GATA12    --------->DOF5.7(1)     <--
 
atcgtacttccagataggagatgaagaagatgaagccattagtctctctctttatggatcaactatttggccaagaaggaggatgaagaaatcatatcaa  27424500
                                                  --------->ATHB12                        ------>NtERF2
                                                  <---------ICU4                         --------->RAP2.6(2)
                                               --------->YAB1                            --------->DEAR3(1)
                                           --------->LBD16                            --------->ANAC58
                                      --------->WRKY38(1) --------->RVE1(2)           --------->ANAC46
              <---------YAB5          --------->WRKY12    --------->GATA12          <---------ALFIN1
          --------->ARR11(3)        <-------MYC3  --------->YAB5              <---------ALFIN1
------>ARR11(3)   <------------CBF  ------->MYC3 <---------YAB5            --------->ARR11(3)
>RVE1(2)  <---------ARR11(3)        <-------MYC2 --------->ICU4          --------->DOF5.7(1)     <--
-------ARR11(3)--------->YAB1       ------->MYC2 <---------YAB1         --------->YAB1--------->ANAC58
 
gttcttagtacaagataatcatattgtcacaaacttgcacgttgtccgtataatgatttcaaatccatggttcaataagaccctcccccaagccaccctg  27424600
                          --------->WRKY38(1)
                          --------->WRKY45
                          --------->WRKY12                         --------->WOX13(2)
                 ------------>CBF                                <---------YAB5
             ------->PIF5--------->DOF5.7(2)                     <------NtERF2     *TSS <---------CCA1(2)
             <-------PIF5<---------MYB52(1)                     <-----------TGA1  --------->RVE1(2)
            --------->bZIP60(2)      --------->ANAC58       --------->ANAC46      --------->ARR11(3)
            --------->ANAC46         --------->ANAC58   <-----------GT1           <---------ARR11(3)
            --------->ANAC58     <---------HSFB2a(2)<---------RVE1(2)        ------------>CBF
            --------->ANAC58  <----------DOF2       <---------ARR11(3)      --------->TOE2(3)
-------REM1(1)  <-----------HVH21--------->HSFB2a(2)--------->ARR11(3)     --------->REM1(1)<-------
 
ttgtaacacagttgcacgtcgtcaattcgttgacttttggaagccaaactctctagatattacaaggcgtcattaactacatcaatatctcatttctttg  27424700
                                              <---------ANAC58
                                         --------->YAB1
                                         <---------ICU4                  --------->DAG2
                                        <---------YAB5         <---------At4g35610
                           --------->ZAT14    <---------ANAC58 --------->At4g35610       --------->HSFB2a(2)
                --------->YAB1          <---------YAB1        <-----------HVH21   ------>ZmHOX2a(1)
               <---------YAB5           --------->ICU4      ------>ZmHOX2a(1)     --------->LBD16
               <---------ATHB12       --------->YAB1     ------>ZmHOX2a(1)  --------->ALFIN1       <
---DOF2      --------->WOX13(1) --------->RVE1(2)  <<<<<<<<<TBF1        ---------->DOF2  <---------HSFB2a(2)
 
gtcaaaattcaggcatcaatcatctatctctccactatcgataatcatggcttcttcttcctcctcatcagagcataaagtgttcctgagttttagaaga  27424800
                                               ---------->DOF2
                                           <------ZmHOX2a(2)
                                          --------->GATA12
                                       <---------TOE1(2)                                   ---------
                                      <---------MYB52(1)                                   ---------
                                     <-------GAMYB                                        <---------
                                    --------->MYB55(2)                                <------NtERF2
             <----------DOF2        --------->MYB52(2)                               --------->LBD16
          <---------ARR11(3)        <---------MYB46(3)                              <---------ANAC46
      <---------MYB52(1)           --------->SPL7(1)                            <-----------RAV1(2)
  --------->MYB52(1) --------->At4g35610  <---------GATA12                     <---------ZAT2   ----
--------->ZAT18      <---------At4g35610<---------MYB46(3)                     --------->At4g35610
------ZmHOX2a(1) <-----------HVH21<---------MYB52(1)--------->KAN1             --------->ZAT2 ------
 
gaggacaccggtagaacttttgtcagccatctataccgttcgttggatcaaaaagaaattcgaacttacaaatttgaaaaccagcaggcgggagacggaa  27424900
<- Previous    Next ->

AGI:  At1g72860.1   
Description:  disease resistance protein (TIR-NBS-LRR class), putative. similar to disease resistance protein (TIR-NBS-LRR class), putative [Arabidopsis thaliana] (TAIR:AT1G17600.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO16282.1); contains InterPro domain Disease resistance protein; (InterPro:IPR000767); contains InterPro domain Toll-Interleukin receptor; (InterPro:IPR000157); contains InterPro domain NB-ARC; (InterPro:IPR002182); contains InterPro domain Leucine-rich repeat; (InterPro:IPR001611); contains InterPro domain Leucine-rich repeat 3 (InterPro:IPR011713)
Range:  from: 27419889    to: 27424439    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g72870.1   
Description:  disease resistance protein (TIR-NBS class), putative. similar to disease resistance protein (TIR-NBS class), putative [Arabidopsis thaliana] (TAIR:AT1G72850.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO49902.1); contains InterPro domain Disease resistance protein; (InterPro:IPR000767); contains InterPro domain Toll-Interleukin receptor; (InterPro:IPR000157); contains InterPro domain von Willebrand factor, type A (InterPro:IPR002035); contains InterPro domain NB-ARC; (InterPro:IPR002182)
Range:  from: 27424684    to: 27426845    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version