AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                     --------->AHL20(2)
                                             --------->YAB1
                                        --------->ARR14(2)
                                        --------->GATA12
                                        <---------GATA12
                                        --------->RVE1(2)
                                        <---------ARR11(3)
                                        --------->ARR11(3)
                        ----------->GT1 <---------ARR14(2)
                <----------DOF2         <-----------ARR10
               <---------ANAC58         <---------ARR11(1)
         --------->ARR14(2)            <---------ARR14(1)
         <---------ARR14(2)            ------>MYB83--------->TOE1(3)
      <---------TOE1(2)----------->GT1 ------>MYB46(1)                   ------>ZmHOX2a(2)         -
-------REM1(1) <---------ANAC58        <---------CCA1(2)               <---------GATA12           <-
-REM1(1) --------->ARR11(2)       <-----------GT1  --------->TOE2(3)  <------ZmHOX2a(1)           <-
-ANAC46  <---------ARR11(2)    <---------AHL12(2)  <----------DOF2---------->DOF2               ----
 
ttgtagtccctggttctggctttggacaggtaaaatataaccaaatcttcataactttaaatgtcttacaaaaggatcgaacttgaataatgggttttgg  27240100
                 --------->LBD16
                 --------->HSFB2a(2)
                 <---------HSFB2a(2)
                 ------>ZmHOX2a(1)
                <---------ANAC46
          <---------TOE2(3)                                                                     ----
          --------->MYB59                                                            ----------->HVH21
    <---------TOE2(3) <---------KAN1                                            <---------YAB5  <---
-------->ATHB12 <---------LBD16      <-------TEIL--------->HSFB2a(2)           <---------ARR14(2)
------TEIL<---------TOE1(3)   <----------DOF2    <---------HSFB2a(2)           --------->ARR14(2)
--------YAB5 <---------ARR14(2)    --------->GATA12             --------->GLK1(2)  --------->At4g35610
----->GATA12 --------->ARR14(2)    <---------GATA12     <----------ID1    ----------->GT1   --------
 
attcattgtggtttaggttcctggaacatggcactttagatgcacaatacttccacaagaagacaagattccagcgatagtgaatcgtctgacagagttc  27240200
                                <------ZmHOX2a(1)
                             --------->DOF5.7(1)
                            ---------->DOF2
                         <---------MYB52(2)
                     --------->LBD16
                    --------->HSFB2a(2)
                    <---------HSFB2a(2)
                    --------->ANAC58
                    <---------ANAC55(2)
                 <---------ARR11(2)
                 <---------ARR14(2)
      <-------TEIL <---------LBD16                                       --------->DAG2
     <----------DOF2--------->ANAC58                                     --------->DOF5.7(1)
  --------->ARR11(3)--------->ANAC55(2)                       <---------------AGL15
  <---------ARR11(3)--------->ANAC46                          <---------DAG2                    <---
----->HSFB2a(2)  --------->ARR11(2) ----------->HVH21         <---------DOF5.7(1)               ----
------HSFB2a(2)  --------->ARR14(2)<---------MYB59 ------->TEIL<----------DOF2                 -----
->GLK1(1)       <---------GLK1(1) --------->At4g35610  ---------->DOF2  ---------->DOF2       <-----
 
cacaagagcttcatggacgagttccgcaactaaaaggacctgaccatgaagatgaacttaaagacccttttgaagaaaagtgtgatcagtttgagttatt  27240300
                                                                  --------------->AtSPL8
                                                               <---------AHL25(2)
                                                               --------->AHL25(2)
                                                               <---------AHL20(1)
                                                               --------->AHL20(1)
                                                               <---------AHL20(3)
                                                               --------->AHL20(3)
                                                              <---------AHL12(1)
                                                              <---------KAN1
                                                              --------->AHL12(1)
                                                     <---------WOX13(2)
                                                   --------->AHL25(1)
                                                   <---------AHL25(1)
                                                   <---------AHL12(3)
                                                   <---------AHL25(2)
                                                   --------->AHL25(2)
                                                   <---------AHL20(2)
                                                   --------->AHL20(2)
                                                   --------->AHL12(1)
                                                   --------->AHL25(3)
                                                   <---------AHL25(3)
                                                   --------->AHL12(3)
                                                   <---------AHL12(1)
                                                  <---------AHL25(2)
                                                  --------->AHL20(2)
                                                  --------->AHL25(3)
                                                  --------->AHL20(3)
                                                  --------->AHL25(2)                               <
                                                  --------->AHL12(3)                               -
                                                  <---------AHL25(1)                               -
                                                  --------->AHL25(1)                               -
                                                  <---------AHL20(3)                               <
                                                  <---------AHL20(2)                               <
 --------->DOF5.7(1)                        <---------At4g35610--------->ARR11(3)      <---------KAN1
 ---------->DOF2                      <---------YAB1 --------->WOX13(2)                --------->bZIP60(2)
------AHL20(2)                      --------->YAB1<---------AHL20(1)                 <---------ANAC58
----->AHL20(2)                --------->ANAC58  --------->WOX13(2)<---------------AtSPL8    --------
---->AHL20(2)                 --------->ANAC58  <---------WOX13(2)<---------------AtSPL3<-----------HVH21
----YAB1                  <---------RVE1(2) --------->At4g35610--------->AHL12(1)    <---------ANAC58
 
aaaaaaaagaaaacttgtgttttgaatttgatcaggcaattgtgatcagctaatttaattttagaatattttgtacttccattccatggcatgtcatatg  27240400
                  <---------AHL25(3)
                  <---------AHL20(2)
                  --------->ATHB12
                 <---------AHL25(3)
                 <---------AHL20(1)
                 --------->AHL25(3)
                 --------->AHL20(1)                                          <---------RVE1(2)
                 <---------AHL12(1)                                          --------->ARR11(3)
                 <---------AHL25(2)                                          <---------ARR11(3)
                <---------AHL25(2)                                          --------->YAB1
                --------->AHL12(2)                               <---------AHL12(2)
                <---------AHL12(3)                               --------->AHL12(2)
               <---------AHL12(2)                               <---------AHL25(3)
               --------->AHL12(2)                               --------->AHL20(2)
               <---------WOX13(2)                               <---------AHL12(3)
               --------->WOX13(2)                               <---------AHL12(1)
          ----------->GT1                                       --------->AHL12(1)
       --------->AHL12(2)    <---------YAB1     <---------AHL20(2)         <---------YAB1
--------->CCA1(2)--------->AHL12(1)            <---------YAB1   --------->AHL25(1)
---------ARR14(2)<---------AHL25(1)           --------->AHL12(2)--------->AHL12(3)            ------
-------->ARR14(2)<---------AHL20(2)         --------->AHL25(3)  <---------AHL25(1)        --------->DAG2
-------->ARR11(1)--------->AHL25(2)         --------->AHL20(3)  <---------AHL20(2)       ---------->DOF2
-------->ARR11(3)--------->AHL20(2)         <---------AHL20(3) --------->AHL25(3)    --------->LBD16
---------ARR11(3)--------->AHL25(1)         --------->AHL20(2)--------->AHL12(2)    <---------HSFB2a(2)
---------RVE1(2)--------->AHL12(3)          <---------YAB1    <---------AHL12(3)    --------->HSFB2a(2)
->At4g35610  <---------AHL20(2)             <---------AHL20(2)--------->AHL12(3)   <---------LBD16
 
aagatatgaaaattagtaaatttattgggcttataaatgggccttatattattaatgggccttatatttatttttcatatgatatttctggagaaagcga  27240500
                                                 --------->AHL12(1)            --------->KAN4(2)
                                                 <---------AHL12(1)      <---------MYB52(1)
         ------------>CBF                       <---------AHL25(1)     --------->DEAR3(1)
     <---------ARR11(3)                         --------->AHL20(2) <------ZmHOX2a(2)
     --------->ARR11(3)                         <---------AHL12(2)--------->GATA12
   <---------AHL20(2)                  --------->ANAC58           --------->RVE1(2)--------->HSFB2a(2)
  <---------AHL12(2)                   --------->ANAC58           --------->ARR11(3)              --
  --------->AHL12(2)                *TSS        --------->AHL12(3)<---------GATA12 <---------HSFB2a(2)
<---------ARR11(3)             --------->HSFB2a(1)        --------->ALFIN1    --------->KAN1      <-
--------->AHL20(1)            <---------AHL12(2)--------->AHL25(2)<---------ARR11(3)             ---
----->RAV1(1)   <-----------GT1<---------HSFB2a(1) --------->RVE1(2) <---------At5g28300   ---------
 
cagtatattatcttcaatttttccattttgaagaattttctcaagaaaaaaaaaaatcaatgtggagaagatcaccgtcgtttattctcgacgagcgacg  27240600
                       --------->CCA1(2)                                            <------NtERF2
                       <---------KAN1                                               --------->RAP2.3(1)
                      --------->ARR11(2)                                           <---------ATERF1(1)
                      <---------ARR11(2)                                           --------->DEAR3(1)
                     <------NtERF2                                        ------>MYB46(1)<---------KAN1
                    <---------MYB46(3)                                    ------>MYB83------>NtERF2
       <-----------GT1--------->ARR14(2)                                <---------MYB59  -----------
     <---------KAN1<---------ANAC58                                     <---------MYB46(2)--------->MYB52(1)
    --------->ARR14(2)<---------ARR14(2)           --------->KAN1    <-----------GT1------>NtERF2
------->ZAT2       <---------ANAC46   <----------DOF2           <---------DOF5.7(1)<---------ORA47(2)
--------ZAT2       <---------ANAC58   ------>ZmHOX2a(1)        <---------At4g35610<---------DEAR3(1)
---->TEIL         <---------LBD16    <---------DOF5.7(1)       --------->LBD16   <---------LBD16
-->HVH21          <-----------------------TaNAC69(2)       --------->ARR14(2)  <---------LBD16   <--
 
aagctcgaattcacctccaatggcggatacaacacgaggtccttttcaaaaccctgattccatctccgcttattaccaaactcgcgcggcgcatcacggt  27240700
                                           <---------DEAR3(1)
                                           <---------ANAC46
                                           --------->DEAR3(1)
                                           <---------ANAC58
                                           <---------ANAC58
                                          --------->DEAR4(2)
                                          --------->ATERF1(1)
                                          --------->RAP2.3(1)
                                          <------NtERF2
                                         <---------RAP2.3(1)
                                         <---------ORA47(2)
                                         <---------RAP2.6(1)
                                         <---------ATERF1(1)
                                         <---------RRTF1(1)
                                         <---------ERF1
                                         ------>NtERF2
                                        --------->ATERF1(2)
                                        <---------RRTF1(2)
                                        <---------RAP2.3(2)
                                        <---------RAP2.6(2)
                                        <---------ATERF1(2)
                                        <---------RRTF1(3)
                                        <---------DREB2C(2)
                                        <---------DEAR3(1)
                                        <---------RAP2.3(3)
                                       <------NtERF2
                                       --------->ATERF1(1)                            --------->HSFB2a(2)
                                      <---------ATERF1(1)                             <---------HSFB2a(2)
                                     --------->WRKY12                                <---------LBD16
                                     <---------DEAR3(1)                             <---------LBD16
                                    <---------MYB52(1)                           --------->ARR11(3)
                                   <-------GAMYB                            --------->ARR11(2)
                                  <---------MYB46(3)                        --------->MYB52(1)
                                 <------NtERF2                            --------->LBD16
                                ------>NtERF2                            <---------ANAC55(2)
                               --------->DEAR3(1)                     --------->ARR11(2)
                               --------->RAP2.3(3)              <---------KAN1   <---------GATA12
              <---------ANAC58 --------->RAP2.6(2)      ------>NtERF2 <---------ARR11(2)
              <---------ANAC58 --------->RAP2.3(2)    --------->ATERF1(1)--------->ANAC46
     --------->ANAC58       --------->ANAC58 <------NtERF2    <---------ICU4<---------ARR11(2)
     --------->ANAC58       --------->ANAC46<-----------HVH21<---------ZAT2 <---------ARR14(2)
     --------->ANAC46       --------->ANAC58------>NtERF2    --------->ZAT2 --------->ARR14(2)
>HVH21       <---------STY1(2)--------->RAP2.3(1)    <---------ATERF1(1) --------->ANAC55(2)       -
-------YAB5  --------->STY1(2)--------->DEAR3(2)<-----------RAV1(2)  --------->KAN1------>ZmHOX2a(2)
 
gtcattacaagcgactggctagcccaagctcaagccgccgttggcggcgtctcaggcgatgcccagcatgacttatccgtaactgatctcgggaacgaga  27240800
                                              ------>ZmHOX2a(2)
                                             <------ZmHOX2a(2)
                                             <---------KAN1
                                            --------->GLK1(2)
                                            <---------ARR14(2)
                                            --------->ARR14(2)
                                            <---------GATA12
                                            <-----------ARR10
                                            <---------ARR11(2)
                                            --------->ARR11(2)
                                            --------->GATA12
                                            <---------RVE1(2)                                  <----
                                            <---------ARR11(3)     <---------ARR11(2)          <----
                                            --------->ARR11(3)    <----------DOF2           --------
                                           <---------ARR14(1)   <------NtERF2              <--------
                                           <---------CCA1(2)  <---------ANAC46         --------->KAN1
                                          --------->LBD16     <------NtERF2           <---------MYB52(1)
                                         ------->GAMYB        <---------RAP2.6(2)    <-------GAMYB
                                        <---------LBD16      <---------LBD16      --------->At4g35610
          --------->WOX13(2)           -------->P          --------->ATERF1(1)    <---------At4g35610
          <---------WOX13(2)           --------->MYB52(1)  <------NtERF2          <---------ZAT2
        <---------AHL20(2)           --------->MYB46(3)   <-----------HVH21     <---------RAP2.6(2)
     <---------TOE2(3)       ----------->GT1<---------AGP1<---------RAP2.6(3)  <---------At4g35610
---------->GT1         XXXXXXXXXXXXXXXXXXX>MIR773B*      --------->DEAR3(1)<----------DOF2 <--------
 
agtcgtttaatgtaattgaagagttcaataactggagaaaacaaccggatctggctgaagccgtcgcggctatacgagctttggctgctgttattcgtgc  27240900
                                                 --------->ARR11(2)
                                               <---------YAB1
                                        --------->DOF5.7(1)
-----ANAC58                            --------->DOF5.7(1)                             --------->KAN1
-----ANAC58                           ---------->DOF2 --------->ANAC46         <----------DOF2
->TOE1(2)     --------->ATHB12  <---------At4g35610   --------->ANAC58         <---------DAG2
-ANAC58      --------->ICU4     --------->At4g35610   --------->ANAC58      <-----------GT1
-ANAC58      <---------YAB1--------->WOX13(2)<---------At4g35610          <-----------GT1       <---
 
gagcgaagcgagcaccatgatggagcttgaaattgagctcaaaaaggcttctgatacactcaaggtgagaattcatttttcactttctgttcattcttcg  27241000
<- Previous    Next ->

AGI:  At1g72330.1   
Description:  ALAAT2 (ALANINE AMINOTRANSFERASE 2); alanine transaminase. similar to ALAAT1 (ALANINE AMINOTRANSFERAS), alanine transaminase [Arabidopsis thaliana] (TAIR:AT1G17290.1); similar to alanine aminotransferase [Capsicum annuum] (GB:AAR05449.1); similar to alanine aminotransferase 1 [Glycine max] (GB:ABW17196.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45546.1); contains InterPro domain Aminotransferase, class I and II; (InterPro:IPR004839); contains InterPro domain Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424); contains InterPro domain Pyridoxal phosphate-dependent transferase, major region, subdoma
Range:  from: 27237147    to: 27240450    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g72340.1   
Description:  eukaryotic translation initiation factor 2B family protein / eIF-2B family protein. similar to GTP binding / translation initiation factor [Arabidopsis thaliana] (TAIR:AT1G53880.1); similar to GTP binding / translation initiation factor [Arabidopsis thaliana] (TAIR:AT1G53900.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN62132.1); contains InterPro domain Initiation factor 2B related; (InterPro:IPR000649)
Range:  from: 27240537    to: 27242274    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version