AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                   <---------ARR11(2)                            --------->ARR14(2) --------->AHL25(1)
          <---------DOF5.7(1)                                    <---------ARR14(2) <---------AHL12(1)
          <---------DAG2                                         --------->ARR11(2) --------->AHL12(1)
        -------->P --------->ARR11(2)                            <---------ARR11(2) --------->AHL20(2)
    --------->ANAC58        <---------ARR11(3)                   ------->TEIL --------->ANAC58
    --------->ANAC58  --------->ANAC46                          <---------CCA1(2)   --------->AHL20(3)
------>YAB1<----------DOF2  --------->ARR11(3)           ---------->DOF2    ---------->DOF2  <------
taatgtcaagctaccttttgtatatacacaaggtctctctattgagttgagtcaaacaaacaaagatgtatctgcaagggaaagcaaaaaattccaaatt  26946200
                              --------->WOX13(2)      <---------GATA12
                              <---------WOX13(2)      --------->GLK1(2)
                            --------->AHL20(2) <---------At4g35610
                     <---------At4g35610-------->P    <---------ARR11(3)
                     <---------ZAT2   <---------MYB59 --------->RVE1(2)
        <---------YAB1    --------->ANAC55(2)  --------->At4g35610              --------->YAB5
 --------->KAN1      --------->ZAT2   --------->TOE1(2)             --------->ARR11(2)        ------
-->ARR14(2)          --------->At4g35610------>MYB83  --------->ARR11(3)     ----------->RAV1(1)  --
-->GATA12--------->YAB5   --------->ANAC58  <---------MYB52(1)   --------->ANAC46             ------
---ARR14(2)<---------YAB1 --------->ANAC58--------->YAB5       ----------->RAV1(1)        --------->RVE1(2)
tgctacattctatgattctagctcagctcaagtaattaaaacctaccattagctgaaaatctcataccacataacctctgcaacaattccacatatcaag  26946300
                                 --------->DOF5.7(1)                                        <-------
                                --------->DOF5.7(1)                                         --------
                               --------->DOF5.7(1)                                         ------>MYB83
                               ---------->DOF2                                             ------>MYB46(1)
                              --------->DOF5.7(1)                   <---------AtLEC2     <---------MYB59
--->ANAC58               <------ZmHOX2a(1)                   <---------DAG2          ----------->HVH21
-------->DOF2           ----------->GT1 --------->GLK1(1)    <----------DOF2   <---------ZAT18
--->ANAC58           <---------O2--------->DAG2    --------->WOX13(2)          --------->ZAT18
ctaaagctactgagcaaaaaactcacgaggaaaaaaaaggctgaattcttgagaaattagcaaacttttttgcataaacaagttcgctctgacctagcta  26946400
     <---------------AtSPL8                                                                   ------
    <---------YAB5 --------->HSFB2a(1)                                                      <-------
<---------ZAT14    <---------ICU4        --------->TOE2(3)                             --------->TOE1(3)
--------->ZAT14   <---------YAB5         --------->TOE1(3)        <---------DAG2      ----------->GT1
--STY1(2)         <---------ATHB12 <---------AHL12(2)             <----------DOF2  ---------->DOF2
->STY1(2)<---------ZAT14  --------->ANAC46             --------->KAN1   <---------AtLEC2    --------
ctgagtagtgagtactgagcaaacattccacgagaaaaaaaaaaccttaattcttgagaaattcgaaaactttttgcataaacttgaaaagcttaaatta  26946500
                                                    ------>MYB83                     --------->TOE1(3)
                                      --------->KAN1------>MYB46(1)                  --------->TOE2(3)
                                      <----------TaMYB80                             <---------MYB59
   <---------RVE1(2)                 <---------MYB52(1)   <---------TOE1(2)     <---------KAN1
--->YAB1                             <---------RVE1(2)<---------ATHB12    --------->YAB5
--WOX13(2)                           <---------ARR14(2)   <---------TOE2(2)    --------->WOX13(2)
->WOX13(2)                           --------->ARR14(2)--------->YAB1    --------->DOF5.7(1)
gaatcagataatgaattcttcaaaccagaaaaacttcaccgatattcccaaaaccaaatcatatgttttcaatcgaaagactaataaacctaaaccctct  26946600
                    <---------ANAC58                                       ---------->DOF2
                    --------->ATERF1(1)                                 --------->LBD16
                    <---------ANAC46                                   --------->HSFB2a(2)
                    <---------ANAC58                                   <---------HSFB2a(2)
                    <---------ORA47(1)     <-----------GT1          <---------GATA12
                   <---------ATERF1(1)     --------->ARR11(2)       --------->ARR11(2)
               <---------O2       <---------ANAC58                  --------->ARR14(2)
               --------->O2   <---------ANAC58                      <---------ARR14(2)
             *TSS--------->ALFIN1 <---------ANAC58                  <---------ARR11(2)             <
           <------NtERF2      <---------ANAC58                      --------->GATA12               <
          ------>NtERF2     <---------ARR11(3)                      --------->RVE1(2)              -
          --------->LBD16   --------->ARR11(3)                  ----------------->AGL2--------------
         <---------LBD16   --------->GLK1(1)                    ----------------->AGL1<-------------
         --------->LBD16   <---------GLK1(1)                  ---------->ID1      ---------->DOF2  <
        <---------LBD16<------NtERF2<---------DOF5.7(1)   <---------MYB52(1)--------->DOF5.7(1)  ---
gttttctatttcccggcgaagtggccggcgatatcttgcttttttgtaacctctgttttctgtttggcccaaatccagaaaagcccaaagcccatttggg  26946700
        <---------AHL12(3)                                        --------->ARR14(2)
       --------->AHL20(2)                                         --------->ARR11(2)
     <---------WOX13(2)                                           <---------ARR14(2)
     --------->WOX13(2)                                           <---------ARR11(2)
    --------->YAB1                                               --------->KAN1
  --------->AHL20(3)                                          --------->ANAC58
  <---------AHL12(3)                                          --------->ANAC58
  <---------AHL20(3)                                         ------->TEIL                    <------
  --------->AHL25(1) <---------AHL20(2)                    <---------SPL7(1)             <---------ANAC46
<---------RVE1(1)  <---------WOX13(2)                    <---------------AtSPL3      --------->YAB5
<---------CCA1(1)  --------->WOX13(2)               <---------ETT(1)                 <--------ATHB1
---------ARR11(3)<---------YAB1                     --------->ANAC58                 --------->KAN1
---------RVE1(2)--------->AHL20(3)                  --------->ANAC58                --------->AHL12(1)
-------->ARR11(3)<---------AHL20(2)          ---------->DOF2 <-------TEIL           <---------KAN1
--->AGL1--------->AHL12(3)          <---------KAN1  --------->ANAC46                <---------AHL25(1)
----AG --------->YAB1--------->AHL20(2)    <-------TEIL <------------------SPL14    <---------AHL12(1)
---------ARR14(2)--------->AHL20(2) --------->ALFIN1----------->HVH21       <---------ANAC55(2)  <--
-------->ARR10<---------AHL12(2)  <---------------------WRI1 --------->SPL7(1)   --------->YAB5  <--
aagatattaataaaaatattttaattaaaaaatagacgggtatgggttcaaagacccgacaacgtacggtattcgggttacatatgaataattcgggtat  26946800
              --------->AHL20(2)                         ---------->DOF2
           <------ZmHOX2a(1)                            <---------WRKY45
           --------->YAB5---------->DOF2                <---------WRKY12                 --------->bZIP60(1)
         <---------TOE2(3)                              <---------WRKY38(1)              <---------bZIP60(1)
---KAN1  <---------TOE1(3)                    --------------->AGL15         ----------->GT1
-------AHL12(3) <---------WOX13(2)         <-----------GT1           ----------->GT1     -----------
-------AHL20(2) --------->WOX13(2)  ----------->GT1    --------->WRKY18(1)<---------WOX13(2)<-------
atatatgtttttaaggattaattagaaacaaagagattacagtaatatactatgtatggtcaaagttgaaactcgtaaattgtgaatttgtgatgttact  26946900
           --------->AHL25(2)                                                <---------AHL20(2)
           <---------AHL20(2)                                               --------->AHL20(2)
           <---------AHL25(1)                                     <---------AHL20(2)
           --------->AHL12(1)                                     --------->AHL12(1)
           <---------ICU4                                         <---------AHL12(1)
          <---------AHL12(2)                                      <---------AHL12(3)
          --------->AHL12(2)                                      <---------AHL25(1)
         --------->AHL12(2)                                       --------->AHL20(2)
         <---------AHL12(2)                                       --------->AHL12(3)
         <---------AHL25(2)                                       <---------AHL25(3)
         --------->AHL20(3)                  --------->RVE1(2)    --------->AHL25(1)
         <---------AHL20(3)                 <---------CCA1(2)    --------->AHL25(3)
         --------->AHL25(2)            <---------GATA12          <---------AHL20(2)
        --------->AHL12(1)      --------->ICU4                  --------->AHL12(2)
  <---------At4g35610          --------->ANAC58       --------->YAB1  <-----------GT1            ---
  --------->At4g35610          --------->ANAC58      <---------YAB1<---------AHL12(2)           <---
>GT1----------->GT1<---------DOF5.7(1) --------->GATA12       <---------AHL20(2)            <-------
----GT1 <---------AHL12(1)   <---------AtLEC2--------->GATA12--------->AHL25(3)  <---------------AtSPL8
agatgagctgataattttttccttttttttttgcaaggattgaatccaaatctcttatgatgtttttatttattttccattttataagtacaagacttta  26947000
                          --------->AHL20(2)  <---------ANAC58        <---------AHL12(3)
                          <---------AHL25(2)  --------->ANAC55(2)     --------->AHL25(2)
                       --------->YAB1         <---------ANAC55(2)     --------->AHL20(2)
                      <---------YAB1    <---------YAB1                <---------AHL25(2)   ---------
                  ----------->GT1      <-----------GT1                <---------AHL25(1)   <--------
                ---------->DOF2      <---------AHL12(1)  ---------->DOF2            <-----------GT1
  <----------DOF2--------->DAG2      --------->AHL12(1) <------ZmHOX2a(1)        --------->AHL12(2)
------>YAB1  <---------ANAC55(2)    --------->AHL12(2)<---------TOE1(3)          <---------AHL12(2)
------YAB1   ----------->GT1        <---------AHL12(2)<---------TOE2(3)   ----------->GT1<------ZmHOX2a(1)
---DOF2   --------->DOF5.7(1)  ----------->GT1<---------ANAC58----------->GT1  --------->ICU4     --
ttatacttttaaaaaaacgtaaagtataataaaattgtaaattttcaatgcgtacttaaggaaagtcgttaaaaaaaatgtaatatttaacaggatgtca  26947100
<- Previous    Next ->

AGI:  At1g71528.1   
Description:  other RNA
Range:  from: 26943224    to: 26946614    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g71530.1   
Description:  protein kinase family protein. similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT1G33770.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO46874.1); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threonine protein kinase, active site; (InterPro:IPR008271); contains InterPro domain Tyrosine protein kinase; (InterPro:IPR001245)
Range:  from: 26943229    to: 26946614    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version