AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                      <---------AHL12(2)
                                      <---------AHL20(2)
                                      --------->AHL20(1)
                                      <---------YAB1
                                      <---------AHL25(2)
                                      <---------AHL20(3)
                                      --------->AHL20(3)
                                     <---------AHL25(1)
                                     <---------AHL12(3)
                                     <---------AHL25(2)
                                     <---------AHL25(3)
                                     --------->YAB1
                                     --------->AHL12(3)
                                     --------->AHL20(2)
                                     <---------AHL20(3)                     <---------ANAC58
                                     --------->AHL20(3)                     <---------ANAC58
                               ----------->GT1                              <---------ANAC46
                           <---------ZAT2                                  <-------TEIL
                           --------->TGA1a                   <-----------ARR10
                           <---------At4g35610               <---------ARR14(2)
                           --------->At4g35610               --------->ARR11(2)
                           --------->ZAT2                    <---------ARR11(3)
                          <---------TOE1(2)                  --------->ARR11(3)
                          <---------TOE2(2)                  --------->RVE1(2)
                         <-----------RAV1(2)                 --------->ARR14(2)
                    <---------KAN1--------->YAB1     ----------->GT1   <---------TOE1(3)
                    <-----------RAV1(1)        --------->ANAC58        <---------TOE2(3)
--->MYB52(1)        =================RAV       --------->ANAC58    <---------DOF5.7(1)           ---
>YAB1    <-------TEIL<-----------HVH21--------->AHL25(2)    <---------CCA1(2)        <-----------GT1
 
ctgtggaacaggtccatggactaatgtcgcaggtgagtaataatattgaaacgaaatggtgacatatctcccttaaggttcgtgtatttcacagactcaa  26857800
                                                                                        <------ZmHOX2a(2)
                                                                                       --------->ARR11(2)
                                                                                       --------->ARR14(2)
                                                                                       <---------GATA12
                                                                                  <-----------HVH21
                                                                                 <---------TGA1a
                                    --------->KAN1                          ----------->HVH21
     <---------YAB1                 --------->AHL12(1)             --------->ARR14(2)  <---------ARR11(2)
   --------->YAB1                   --------->AHL25(1)             --------->GATA12    --------->GATA12
   --------->ATHB12                 -------->ATHB1 <-----------HVH21     <---------ALFIN1------>ZmHOX2a(2)
   <---------ICU4                   <---------AHL12(1)        ----------->RAV1(1)<---------O2
   -------->ATHB1                  <---------YAB5  <-----------TGA1<---------GATA12    <---------ARR14(2)
  <---------YAB1          ---------->DOF2         <---------ANAC58 <---------ARR14(2)<---------DEAR3(2)
  <---------ATHB12 <------MYB46(1) --------->AHL12(1)        --------->MYB46(3)  --------->O2      <
--------->WOX13(1) <------MYB83    <---------AHL12(1)      ----------->RAV1(1)   --------->TGA1a   <
------>RVE1(2)   <--------P --------->DOF5.7(1)   <---------ANAC58 --------->RVE1(2)<---------TOE1(2)
 
aatccatcattgttgtacttgtaggtcataaaagatgaattattcaactcaatgcgtcagtccaacaacaaatctcccactgactcgtcggatccagacc  26857900
                                                     --------->ATHB12                            ---
                                                     <--------HAHB4                    ---------->DOF2
                                                    <---------ATHB12                <---------ANAC46
                                                 --------->MYB46(3)      <---------AHL12(2)     <---
                                              <---------WRKY18(1)       --------->AHL20(2)     <----
            <---------TOE2(3)                ----------->HVH21          --------->AHL12(3)     -----
      <---------RVE1(2)                      --------->WRKY38(1)        <---------AHL20(2)     <----
     <---------ANAC55(2)          --------------->AGL15                 --------->AHL25(1)     -----
     --------->ANAC55(2)          <---------------AGL15                 <---------AHL25(1)     <----
<---------ICU4                   <-----------------AGL2  <---------MYB46(3)      <---------MYB52(1)
--------->YAB1                   <-----------------AG<---------ICU4    --------->AHL20(2)      -----
--------->ATHB12                 <-----------------AGL3  <-----------RAV1(1)   <-----------RAV1(1)
--------->YAB5          <----------DOF2     <---------WOX13(1)         --------->AHL25(3)      -----
---------YAB1          <---------DOF5.7(1) <------------CBF      <----------DOF2<-------GAMYB ------
---------ATHB12     <---------DOF5.7(1)    --------->GATA12      ------>ZmHOX2a(1)<---------ANAC46
 
ctatgattacatattgaagttgctcttcttttggtttctagttttggattgacccatcatttgttgtcctttcatttattttctgttgtgtaaagaatta  26858000
      --------->YAB1
    <---------WOX13(2)
--------->YAB1                    ---------->DOF2
------>YAB1              --------->ARR11(3)                                        --------->YAB1
------YAB1  --------->YAB1   <---------TOE2(3)                                 --------->KAN4(1)
-----AHL20(2)            <---------GATA12                                      <---------KAN4(1)
---->AHL20(1)            <---------ARR11(3)                                    --------->KAN1
-----AHL25(2)            <---------GLK1(2)                                     <---------KAN1
---->AHL20(2)            <---------ARR14(2)                             ---------->DOF2
-----AHL20(3)            <---------ARR14(3)                          <-------GAMYB --------->TOE2(3)
---->AHL20(3)            --------->ARR14(3)                        <------NtERF2--------->YAB1
---->AHL25(2)          ----------->ARR10                         <---------DEAR3(1)--------->TOE1(3)
--->YAB1   <---------KAN1<---------RVE1(2)                   <-------TEIL     <---------KAN4(2)
 
taatgctaatgagaataatacagaagaagattttggttaaagaaatgtttttaagcccattcgattcgtcggggttaaaggaataatcttaagcccttaa  26858100
                                                                                               -----
                                                                                              <-----
                                                                                              ------
                                                                                    <---------ANAC58
                                <---------RVE1(2)                                   <---------ANAC58
                --------->GLK1(1)  <----------DOF2                              --------->WRKY38(1)
                <---------GLK1(1) ------>ZmHOX2a(2)                   <---------ZAT18         ------
            <---------TOE2(3)   <---------ARR11(3)         <----------DOF2      --------->WRKY12
         --------->ICU4         --------->ARR11(3)  <---------ALFIN1  --------->ZAT14  --------->REM1(2)
        <-----------TBP       <---------YAB5   --------->ARR11(2)     <---------ZAT14--------->LBD16
  <------------CBF --------->YAB1 <---------DOF5.7(1)     <---------DOF5.7(1)<---------O2     <-----
 
acaaaaattgtatttatggaaatcagaaacctagtgatcttttccaactctatcccctctctctttccttctctgcactcacgttgtccgtgaataggtg  26858200
                                                                                       --------->RAP2.3(3)
                                                                                     ------>NtERF2
                                                                                     <---------ATERF1(1)
                                                                                    --------->DEAR3(1)
                                                                                   --------->ATERF1(1)
                                                                                  <---------ATERF1(1)
                                                                                  ------>NtERF2
                            <----------DOF2                                      --------->DEAR3(1)
                           <---------DOF5.7(1)                 ------>ZmHOX2a(1) <---------DEAR3(1)
                        --------->YAB1                   --------->ALFIN1       <-------------------
------>GT1             <---------YAB5                 --------->DAG2       --------->ETT(2)
----------AtSPL8       <---------ATHB12      <-------GAMYB    <---------ANAC58 ------>NtERF2
--->ALFIN1   ------------>CBF               --------->MYB52(2)<---------ANAC46 --------->YAB5
--------->AtSPL8     --------->WOX13(1)     <---------MYB46(3)<---------ANAC58--------->DEAR3(1)
----------AtSPL3   ------------>CBF   <----------DOF2---------->DOF2       <---------ETT(2) --------
 
gtactaaaacatggctaacaatggcaatcatctttctctgtctttgtttgttgatgaaaagtgttccttatgggactgtcgacgacgacgcccacaagga  26858300
                                                                                                  --
                                                                                                 <--
                                                                                                ----
                                                    --------->ANAC46                            <---
                                                  --------->ANAC58                              <---
                                                  --------->ANAC58                              ----
                                                  --------->ANAC46                              <---
                                               --------->ZAT14                                  ----
                                               <---------ZAT14                                 <----
             ----------->HVH21              ------->TEIL                                   ---------
           ----------->RAV1(2)            --------->ZAT18                                 <---------ANAC58
          ------>MYB83                    <---------ZAT18                                 <---------ANAC58
--WRI1    -------->P                     --------->ANAC58                                 <---------ANAC46
->ANAC46  ------>MYB46(1)                --------->ANAC58                                <---------LBD16
 
gctatgtactgccaacctgaccatcttcaacaagcttatcaagaacgcacttcacacaacatggcaaacttatacacttgaagacgtagtattgcggaga  26858400
                          <---------ANAC46
                      --------->HSFB2a(1)
                      <---------ZAT2           ------>MYB46(1)
                      --------->HSFC1(2)       ------>MYB83
                      <---------At4g35610    <---------MYB46(2)
                      <---------HSFB2a(1)    <---------MYB59
                      <---------HSFC1(2)     <---------MYB111(1)
                      --------->At4g35610    --------->AtMYB61                              <-------
                      --------->ZAT2      --------->GLK1(1)                                 --------
   ---------->DOF2   <-----------ARR10   <---------ARR11(2)                                 <-------
------->TOE2(3)      --------->ARR14(2)  <---------ARR14(2)                                <--------
-------KAN1 <---------WOX13(2)           --------->ARR11(2)                                ---------
----->ARR14(2)       <---------ARR14(2)  --------->ARR14(2)                                <--------
------ARR14(2)     --------->LBD16    --------->LBD16                                      <--------
--------ARR10     --------->ANAC46   <---------LBD16                                       ---------
----->GLK1(2)    <---------LBD16    <---------ANAC46                                    --------->ANAC58
------ARR11(3)--------->KAN1        <---------LBD16             <---------MYB52(1)   --------->LBD16
----->RVE1(2)<---------YAB5        <---------LBD16--------->TOE2(3) <---------MYB52(1)  --------->ANAC58
-----GLK1(2)--------->WOX13(2)  <---------GLK1(1) --------->TOE1(3)<-------GAMYB     <---------SPL7(1)
>LBD16  --------->TOE2(3)<-------TEIL--------->LBD16           <-----------HVH21   <---------LBD16
 
atcttagaaagccttagttatccggagcttcgtggaagtccggggataccaaaccttcaagaaaacagtcagttattgtctatagctccgcacggatatg  26858500
 ------>ZmHOX2a(1)
--KAN1
->GLK1(1)                                                                                   --------
--GLK1(1)                                                                                   --------
-RVE1(2)                                                     <---------ETT(1)              ---------
>ARR11(2)                         ------->MYC3         <---------ANAC58                <------------
-ARR11(2)                         <-------MYC3         <---------ANAC58               ---------->DOF2
-ARR14(2)          <---------ANAC46    <---------MYB46(3)    ----------->HVH21    ----------->GT1<--
>ARR14(2)     <---------REM1(1)  <---------KAN1    <----------DOF2      --------->ALFIN1  --------->MYB52(1)
 
tttcctacaaatttgacatgtagcgagaaacatagcatatggctgtttctcgcgctgttcgtgcccgaccaaggggtttggaaactggttaaagaacggc  26858600
                       <---------AHL25(3)
                      --------->AHL20(3)
                      <---------AHL20(3)
                      --------->AHL20(2)
                      --------->AHL12(3)
                      <---------AHL12(3)
                     --------->AHL12(2)
                     <---------AHL12(2)
                    --------->AHL20(3)
                    <---------AHL20(3)
                    <---------AHL12(3)
                   --------->AHL25(3)
                   <---------AHL12(1)
                   <---------AHL20(2)
                   --------->AHL12(1)
             --------->ANAC55(2)
             <---------ANAC55(2)
 <---------TOE1(2) --------->AHL20(2)
->ANAC58     <---------ANAC58                                                 ----------->GT1
->ANAC58--------------->AtSPL8                                 --------->At4g35610  --------->DAG2
>RAP2.6(3)   <---------ANAC58   <-------MYC3             --------->TOE1(2)  <---------At5g28300    <
---AtSPL3   ------->TEIL        ------->MYC3     <---------MYB46(3)   <---------TOE2(3)       ------
----NtERF2  <-------TEIL  <-----------GT1  <<<<<<<<<<<<<<<<<LFY<---------At4g35610 ---------->DOF2 <
 
atcgaaggaactatgtacgtgataaatttataccacgttttgctatgaacaatggttcaacatgggagctatataggtttacagtgaaaagtgactctgt  26858700
<- Previous    Next ->

AGI:  At1g71230.1   
Description:  AJH2/CSN5/CSN5B (COP9-SIGNALOSOME 5B); protein binding. Identical to COP9 signalosome complex subunit 5a (CSN5A) [Arabidopsis Thaliana] (GB:Q9FVU9;GB:O82523); similar to AJH1/CSN5A/JAB1 (COP9 SIGNALOSOME 5A) [Arabidopsis thaliana] (TAIR:AT1G22920.1); similar to JAB [Lycopersicon esculentum] (GB:AAG43411.1); contains InterPro domain Mov34-1 (InterPro:IPR003639); contains InterPro domain Mov34/MPN/PAD-1 (InterPro:IPR000555)
Range:  from: 26856123    to: 26858058    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g71235.1   
Description:  unknown protein
Range:  from: 26858221    to: 26858884    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version