AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                            <---------ARR14(3)
                            <---------ARR11(3)
                            --------->GATA12
                            --------->ARR14(2)
                            <---------ARR14(2)
                     <---------ARR11(2)
                     --------->ARR14(2)
                   --------->HSFC1(2)
                  <---------O2
                ------>NtERF2--------->ARR14(1)
               --------->DEAR3(1)
               ----------->HVH21
               <---------DEAR3(1)
              --------->ATERF1(1)
              <------NtERF2 <---------ARR11(2)
              --------->RAP2.3(1)
             <---------RAP2.6(1)
             <---------ATERF1(1)
             <---------RRTF1(1)
             ------>NtERF2  --------->ARR11(2)
             <---------DEAR4(2)
             <---------RAP2.3(1)
             <---------ORA47(2)
            <---------ANAC46--------->ARR11(3)
            --------->DEAR3(1)
            <---------DEAR3(1)
            <---------RAP2.3(2)
            <---------RAP2.3(3)
            <---------ATERF1(2)
           <---------ABI4(1)--------->AGP1
           ------>NtERF2   <---------GLK1(1)
           --------->ATERF1(1)        <---------SPL7(1)
           <------NtERF2  ----------->ARR10
          <---------ATERF1(1)<------ZmHOX2a(2)
         <---------DEAR3(1)--------->KAN1                    ----------->GT1
    ------>ZmHOX2a(2)<---------ARR14(2)    --------->At5g28300
  <---------RVE1(2)<---------HSFC1(2)<---------ANAC58      --------->GLK1(1)
  <---------ARR11(3) --------->ARR11(2)   ----------->GT1  <---------GLK1(1)
  --------->GATA12--------->O2       <---------ANAC58     --------->ARR11(2)
  --------->ARR11(3)--------->DOF5.7(2)   <---------ZAT6  <---------ARR14(2)                     <--
----------->ARR10<------NtERF2    <----------DOF2         <---------ARR11(2)                    ----
---------DOF2<---------ERF1--------->GLK1(1)            --------->LBD16                        -----
---DOF5.7(2)--------->ATERF1(2)  <---------DOF5.7(1)  <---------LBD16                      ------>ZmHOX2a(2)
--WRKY12 <---------RAP2.6(2)<---------GATA12          >>>>>>>>>>AtSR1                      ---------
--WRKY38(1)--------->RAP2.3(1)------>ZmHOX2a(2)     --------->DOF5.7(1)                    =========
--WRKY45 <---------RAP2.3(2)--------->ARR14(3)     ---------->DOF2   <----------DOF2     <---------GATA12
>DOF5.7(2)<---------RAP2.3(1)--------->CCA1(2)    --------->DOF5.7(1)<---------DAG2      --------->GATA12
--HVH21 <---------LBD16  --------->LBD16--------->SPL7(1) --------->ARR14(2)      <--------P -------
 
gctttgatcttcgcggcggcgacgtttccgagatccgctttcgtactgtaaaaaaaacgcggaaatgtgaaacttttttcccaaggtaagttgatccaac  26539900
                --------->REM1(2)
              <---------------AtSPL3
             <---------ANAC58
             <---------ANAC46
             <------------------SPL14
            <---------TOE1(2)
          <---------SPL7(1)
         <---------ANAC58
        --------------->AtSPL3
       <-----------HVH21
      <-----------RAV1(1)
     ------>ZmHOX2a(2)
    <------ZmHOX2a(2)
    <---------KAN1
   --------->ARR14(2)
   --------->RVE1(2)
   <---------ARR11(3)
   --------->ARR11(3)
   <---------GATA12
   --------->GLK1(2)
   <---------ARR14(2)                                              ---------->DOF2
   --------->ARR11(2)                                            --------->YAB1                 <---
   <---------ARR11(2) <---------ARR14(2)                        <---------ATHB12               <----
   <---------AGP1 <---------LBD16                              --------->RVE1(2)          --------->AHL12(2)
   --------->GATA12   --------->ARR14(2)                   --------->LBD16                <---------AHL20(2)
  <------ZmHOX2a(1)   <---------ARR11(2)                  --------->ANAC58                <---------AHL12(3)
---------HVH21<---------------AtSPL8                      --------->ANAC58                <---------AHL25(2)
--->GAMYB<---------ANAC46           <------MYB46(1)       --------->ANAC46                --------->AHL25(1)
---->MYB46(3)<---------ANAC58       <------MYB83         <---------LBD16                 --------->AHL12(1)
>MYB46(3)<---------ANAC58          --------->MYB59    --------->KAN1                     <---------AHL12(1)
=========HOX2a_HOX2a  --------->ARR11(2) --------->ICU4  >>>>>>>>>>AtSR1               <---------RVE1(2)
-->MYB52(1) --------->SPL7(1)   --------->ATHB12      ---------->DOF2                <---------YAB1
 
ggtcaggatctgtcgtacgtgtacggattccaaaatgtttggtcatgaagaaaacacaaacgcgcaaatcaaaagaaaacaaaaaactctgatttttttt  26540000
                                                                     <---------ALFIN1
                                                                   <---------RAP2.6(3)
                                                              --------->KAN4(2)
                                                             --------->KAN1     --------->YAB1
                                                             <----------TaMYB80 -------->HAHB4
                                                             <---------KAN4(1) --------->ICU4
                                                             <---------KAN1    <---------ATHB12
                                                             --------->KAN4(1) <---------YAB1
                                                            <---------KAN4(2)  <---------YAB5<------
                          <---------YAB1                  <------ZmHOX2a(1) --------------->AGL15
                     <-------GAMYB                    --------->DOF5.7(1)   <---------------AGL15
                    <---------ANAC58                 --------->DOF5.7(1)   <-----------------AGL2
                    <---------ANAC58                --------->DOF5.7(1) <----------DOF2   <---------YAB1
         <----------DOF2--------->YAB5              ---------->DOF2------>NtERF2<---------ICU4
--------GT1         <---------ANAC46          <------ZmHOX2a(1)   <---------ETT(1)<---------------AtSPL8
-------GT1   <---------RVE1(2)               ----------->GT1---------->TaMYB80<---------TOE2(3)
 
tccgattcaacgctttgattttggcgttgattatggagaaattgtgggaggaaaaaaaagaggaatatgccgacactttctaatgatggtactatgagtc  26540100
                                                    --------->ARR14(2)
                                                    <---------ARR14(2)
                                                    <---------ARR11(2)
                                                    --------->GLK1(2)
                                                    --------->ARR11(2)
                                                --------->SPL7(1)
                                                <---------TOE1(2)
                                              --------->TOE1(2)
                                            --------------->AtSPL8
                                            <---------------AtSPL3
                                          <---------ARR11(2)
                                         <------NtERF2  <---------At4g35610
                                         --------->ATERF1(1)
                                        <---------ATERF1(1)
                                        <---------RAP2.3(1)                      --------->YAB5
                                        ------>NtERF2   <-------GAMYB            <---------ICU4
                                        <---------ERF1 <---------ANAC58         <---------ATHB12
                    ==================HOX2a_HOX2a --------->YAB5          ---------->ID1
                    <------ZmHOX2a(2)  <---------ANAC46<---------ANAC58<---------DOF5.7(1)        --
                    <---------YAB1     <---------RAP2.6(2)            <----------DOF2             --
                   --------->ARR11(3)  <---------RAP2.3(2)            <---------DOF5.7(1)         <-
                   --------->RVE1(2)   <---------RAP2.3(3)           <---------DOF5.7(1)          --
           --------->TOE1(2)   <----------DOF2<---------SPL7(1)     ---------->ID1                --
         ------->TEIL--------->ATHB12  <---------DEAR3(1)         <---------ANAC58                --
    <---------KAN1 <---------ARR11(3) --------->RAP2.6(3)<---------MYB52(1)  ------>ZmHOX2a(1)    --
-----HVH21----------->RAV1(2)  ------>ZmHOX2a(1)<---------TOE2(2) <---------ANAC58      --------->ANAC46
 
agagagagtgtgtacctgagaagatcattgagtcctttaatggcggcttcgtacgattccgttgccatttcgtctttttcctaatgaatacaaacaacaa  26540200
           ----------->GT1
         <---------YAB5
     --------->AHL20(3)
     <---------AHL20(3)
     --------->AHL12(3)
     --------->AHL20(2)
     <---------AHL20(2)                             <---------YAB1
     --------->AHL25(1)                           --------->At4g35610
     --------->AHL25(2)                         ------>ZmHOX2a(2)
     <---------AHL25(1)                         ============================HOX2a_HOX2a
    --------->YAB1                             <---------At4g35610
--------->AHL20(2)                            <---------AGP1
--------->GT1                                 --------->GATA12--------->TOE2(3)
------->ANAC55(1)                             <---------GATA12--------->TOE1(3)
--------ANAC55(2)                             <---------ARR11(2)            ---------->DOF2
------->ANAC55(2)                             <---------RVE1(2)        =====================HOX2a_HOX2a
------->ANAC46                                --------->ARR14(2)       <------ZmHOX2a(2)         <--
------->ANAC58                                <---------ARR14(2)     <------ZmHOX2a(1)      --------
------->ANAC58        <---------TOE2(3)       --------->ARR11(2) ---------->DOF2     <------ZmHOX2a(1)
 
caagtaattttaatcggtgaaatttgacgatgttgaaacatgaaaattggatctgatgagagaaaccttaaaggatcacaaaagcagaggaggttttttt  26540300
                                 *TSS
                                <---------KAN1
                        --------->HSFB2a(2)
                        <---------HSFB2a(2)
                       --------->RVE1(2)                                    <-----------TBP
     <---------LBD16 ------>ZmHOX2a(1)                               <------------CBF
<----------DOF2     --------->TOE2(3)                              <---------RVE1(2)
---------GT1        --------->TOE1(3)        ---------->DOF2       --------->ARR11(3)            ---
->AHL12(2) ----------->GT1      ----------->GT1              <---------RVE1(2)<---------AHL20(2) ---
 
tttctttctctggagagtaaaatccttatcgaagaatgtgaaatcagttaatgcagtagtagtagagatggatattggtatttataggcctagagctcta  26540400
                                                                                              <-----
                                                                                             <------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                          --------->RVE1(1)
                                                                                          --------->CCA1(1)
                                                                                  <---------YAB1  <-
                                                                                 --------->AHL20(3)
                                                                                 --------->AHL25(2)
                                                                                 <---------AHL20(3)
                                                                                 <---------AHL25(3)
                                                                                 <---------AHL25(2)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL25(1)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL20(1)
                                                                                 <---------AHL20(1)
       <------MYB83                                <---------GLK1(2)             --------->AHL20(2)
       <------MYB46(1)                ----------->GT1                  ----------->GT1   <---------AHL12(1)
    <---------MYB52(1)               ----------->GT1                   <------MYB46(1)<---------AHL20(2)
------>YAB1                     <-----------GT1--------->DOF5.7(1)     <------MYB83   --------->AHL20(2)
------>KAN1                <----------DOF2     ---------->DOF2        <---------AtMYB61  --------->AHL12(1)
 
ttatgccatttggttctactcttacattttcttttttacaagggaaaaaaaaaagaaactccacaaaaatgggaaggtttatattatattaaaaaatctt  26540500
                                                                            <-------MYC3
                                                                            ------->MYC2
                                                                   --------->WOX13(2)
                                                                   <---------WOX13(2)
                                                                   <---------AHL12(2)
                                                                  --------->YAB1
                                                                  --------->YAB5
                                                                  <---------ICU4
                                                                  --------->ATHB51
                                        ----------->HVH21         <--------HAHB4
      <------MYB83                    <---------ANAC58           <---------KAN1
      <------MYB46(1)                 <---------ANAC58           --------->AHL12(1)
      ----------->GT1                 ----------->GT1            --------->ICU4
     <---------AtMYB61                <---------ANAC46           <---------AHL12(1)
     --------->ALFIN1          --------->AHL25(2)                --------->AHL25(3)
-----DOF2                      <---------AHL25(2)             <------ZmHOX2a(1)  <----------DOF2
-----------AGL3                --------->AHL20(3)          <------ZmHOX2a(1)<-------MYC2
>GLK1(2)                       <---------AHL20(3)        <---------TOE2(3)  ------->MYC3         ---
>ARR11(3)                      <---------AHL12(1)     <---------WOX13(1)   <---------KAN1       ----
-ARR11(3) <---------RVE1(2)    --------->AHL12(1)   --------->ATHB12       <-----------RAV1(1)  <---
----------RAV1(1)         <---------AHL20(2)       <---------YAB1--------->AHL25(1) ------->TEIL<---
 
tttgtgggatggtgatttgataaaactattttaaaattttggggtgaaatggttttgattgaggaggaataattaagcatgtggctgtatgtctcggtac  26540600
               <-----------GT1
 <---------AHL20(3)
 --------->AHL20(2)
 <---------AHL20(2)
 --------->AHL25(1)                      --------->AHL25(2)
 <---------AHL25(1)                      <---------AHL25(2)             --------->ETT(2)
 --------->AHL20(3)                      --------->AHL25(1)             <---------ETT(2)
------>YAB5 <---------AHL12(2)           --------->AHL12(3)           --------->YAB5              <-
----->ICU4 --------->AHL20(2)            <---------AHL20(2)           --------->RVE1(2)        -----
------YAB1 --------->YAB1           <-------TEIL<---------YAB1       <---------KAN1  --------->YAB1
------YAB5--------->ICU4        --------------->AtSPL8       --------->KAN1    --------->YAB5  <----
 
tgattaaaatgaaattataaacccatttgaatttccaagtacattttttttataaatgcaaatttcattcgaatgtctacattgactagaatagtttttt  26540700
                <---------AHL25(3)
               --------->AHL20(2)
               --------->AHL25(1)
               <---------AHL25(1)
               <---------AHL20(2)
             ------>MYB46(1)                                                   <---------AHL20(2)
        >>>>>>>>>>WRKY38                                                      --------->AHL25(3)
        <-----------GT1                                                       <---------YAB1
        >>>>>>>>>>WRKY43                                                     <---------AHL12(2)
        >>>>>>>>>>WRKY26                                    ----------->GT1  <---------AHL12(3)
       --------->WRKY38(1)                          --------->DAG2           --------->AHL12(3)
       --------->WRKY12------>ZmHOX2a(2)      ----------->GT1                --------->AHL25(2)
 --------->TOE2(3)   <---------ARR11(3)  --------->ANAC46 ------->MYC3       --------->AHL12(2)
--------->ANAC46<---------AHL20(2)    --------->ARR11(2) <---------KAN1      <---------AHL25(2)
----------GT1------>MYB83         --------->DAG2   --------->DOF5.7(1)      <---------ICU4
---------->AtSPL8    --------->ARR11(3)<---------DOF5.7(2)<-------MYC3     --------->ICU4
-------GT1 <---------MYB59       ---------->DOF2   ---------->DOF2    ----------->GT1  <---------REM1(1)
 
tctacctcatttgaccaaataaatgatctcgacttgaaaagtaaacgcagggcaaaaagcatatggtagtaagtagtaatttttattttggtgaaggcaa  26540800
<- Previous    Next ->

AGI:  At1g70410.1   
Description:  carbonic anhydrase, putative / carbonate dehydratase, putative. similar to carbonic anhydrase, putative / carbonate dehydratase, putative [Arabidopsis thaliana] (TAIR:AT1G23730.1); similar to unknown [Populus trichocarpa] (GB:ABK94740.1); contains InterPro domain Carbonic anhydrase, prokaryotic-like, conserved site; (InterPro:IPR015892); contains InterPro domain Carbonic anhydrase; (InterPro:IPR001765)
Range:  from: 26537589    to: 26540334    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version