AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     ---------->DOF2
   --------->At5g28300
  <---------ANAC46
  ----------->GT1
<---------ZAT18
--------->ZAT18
--AHL25(1)
--AHL25(3)
->AHL12(1)
--AHL12(1)
->AHL20(1)
->AHL20(2)
--AHL25(2)
->AHL25(2)
--AHL20(2)
>AHL25(2)
>AHL25(3)                        <---------YAB1
>AHL12(3)                     ----------->GT1
>AHL20(2)                <---------ANAC58                            <---------GLK1(2)         <----
-AHL12(3)                <---------ANAC58                        <---------At5g28300 <---------AHL20(2)
>AHL25(1)                <---------ANAC46                       <-----------GT1      --------->AHL20(2)
-AHL25(2)           <---------REM1(1)  ---------->DOF2 <---------ARR11(3)          <---------WOX13(2)
-AHL25(1)   ----------->GT1 ----------->GT1            --------->ARR11(3)         --------->YAB1
 
tggtgcggtaaagaatggtaaaattgtagcgaggtgataatagaaagttgttaagaaacatctcaaattacagcatcttggccgataataaaactaatat  26380600
                                   <---------ANAC58
                     --------->AHL12(2)
                    <---------AHL25(3)
                    --------->AHL12(3)
                    <---------AHL25(1)
                    <---------AHL12(3)
                    <---------AHL20(2)
                    --------->AHL25(1)
                   --------->AHL20(2)
                   --------->AHL12(1)
                   --------->AHL25(3)
                   <---------AHL20(2)
                   <---------AHL12(1)
          <---------YAB1           <---------ANAC58                   <---------ALFIN1
        --------->YAB1     <---------ANAC58                          <---------ZAT18
        <---------ICU4     <---------ANAC58                          --------->ZAT18         <------
       <---------YAB5<---------AHL12(2)        <---------RVE1(2)     --------->ZAT14    <---------ZAT6
      <---------RVE1(2)   ---------->ID1      --------->KAN1   <---------ZAT2        --------->LBD16
<---------YAB1 <---------YAB1   >>>>>>>ZML2<----------DOF2     --------->ZAT2       --------->LBD16
-------GT1<---------YAB5 <-----------GT1<----------DOF2    <---------ATHB12  ---------->DOF2 <------
 
actatgtttgatcatcatatgatttatttttcgttctagcctgcttctttgattcgtagccaaacaagctggagcactcccaaagtcccgagtcttaacg  26380700
                                                                                                ----
                                                                                               <----
                  ---------->DOF2                                                              <----
               <------ZmHOX2a(2)                                                          --------->ZAT6
              --------->RVE1(2)                                                          <---------TOE2(3)
              --------->GATA12                                                        <---------ATHB12
              <---------GATA12                                                       <---------WOX13(2)
              --------->ARR11(3)                                                  ------------>CBF
              <---------ARR11(3)                                     ----------->HVH21<---------MYB52(2)
             ------->GAMYB                                    <-----------GT1--------->YAB1    <----
           <---------TOE2(3)                        --------->HSFB2a(2)     <-------TEIL<-----------GT1
          <---------DOF5.7(2)      ------->TEIL     <---------HSFB2a(2)  --------->YAB5 --------->MYB52(1)
---TOE1(3)<-----------GT1----------->RAV1(1)     ------>ZmHOX2a(1)  --------->SPL7(1)--------->WOX13(2)
---TOE2(3)--------->MYB52(1)  ---------->DOF2    <----------DOF2  <-----------HVH21 --------->WOX13(1)
 
ttttatggcccattaacgatctaaagcccaacataaagaacctatttctatcctttgagaagttttctctgtccgacgattcatagccaattaacgctaa  26380800
                                                                          -------->HAHB4
                                                                         <---------YAB5
                                                                    --------->ANAC55(2)
                                                                  --------------------->WRI1
                                                                <---------AHL25(3)
                                                                <---------AHL25(1)
                                                                --------->AHL20(2)           <------
                                                                <---------AHL20(2)           -------
                                                               <---------AHL25(3)            <------
                                                               --------->AHL25(3)            <------
                      --------->AHL20(1)                      --------->AHL25(2)             <------
                      <---------AHL20(1)                      <---------AHL12(3)             <------
                      --------->RVE1(2)                      --------->AHL12(2)              -------
                      --------->ARR11(3)                    --------->AHL12(1)              <-------
                      <---------ARR11(3)                    <---------AHL20(3)              --------
                     --------->CCA1(1)                      --------->AHL20(3)              --------
                     --------->RVE1(1)                      <---------AHL12(1)              <-------
                    <---------AHL12(1)               --------->GLK1(2)   --------->ICU4     <-------
           <---------AHL20(2)                        --------->RVE1(2)   <---------YAB1     <-------
           <---------AHL25(3)                        <---------GATA12   <---------WOX13(2)  --------
           <---------AHL25(1)                        --------->GATA12 <---------AHL20(2)    --------
      <---------AHL20(2) <----------DOF2      <-----------GT1<---------AHL12(2)             --------
 <---------YAB1     --------->AHL12(1)      <---------WOX13(2)<---------AHL12(2)            --------
----->YAB5 --------->AHL25(1)               --------->WOX13(2)--------->AHL12(3) --------->ARR11(3)
-----YAB1 --------->AHL20(2)         ---------->DOF2 <---------ARR11(3) --------->WOX13(2)  <-------
-----TOE1(3)        <---------AHL25(2) ----------->GT1     --------->AHL25(3)    <---------ARR11(3)<
-----TOE2(3)   --------->TOE2(3) ---------->DOF2 <---------MYB59<---------AHL12(3)          <-------
 
gattactatttgatttaatctaaaatatctttagcgaaaagaaagttatttaccaaaatctaaaaatttatatgtaattatcgaaatctttttaaaaaat  26380900
        -------->HAHB4
       --------->ICU4
       <---------YAB1
       <---------YAB5
      --------->WOX13(2)
      <---------WOX13(2)
    <---------AHL20(2)
  <---------ANAC55(2)
  --------->ANAC55(2)
  ----------->GT1
---AHL12(2)
-->AHL12(1)
---AHL25(3)
---AHL12(1)
---AHL12(3)
---AHL25(2)
-->AHL25(2)
--AHL25(3)
->AHL25(3)
->AHL25(2)
--AHL20(1)                                                                                  --------
--AHL25(2)                                                --------->TOE1(3)                 <-------
--AHL20(2)                                       <----------DOF2                 --------->GATA12
->AHL20(2)                                  <----------DOF2                      <---------GATA12
->AHL12(3)                   ------------>CBF    --------->TOE2(3)        --------->CCA1(2) --------
->AHL25(1)               --------->YAB1    <---------DOF5.7(1)>>>>>>>>>MYB98<---------ANAC55(2)  ---
->AHL12(1)     --------->ARR11(3)       ------>MYB83      --------->TOE2(3)<-------TEIL <-------TEIL
--AHL12(1)     <---------ARR11(3)       -------->P   --------->WOX13(2)<---------------AtSPL8  -----
---------RVE1(2)     <---------YAB1     ------>MYB46(1)<-----------GT1 --------->DOF5.7(1)  <-------
--AHL25(1)     --------->GATA12    <-----------GT1  --------->YAB1   ---------->DOF2<-----------RAV1(1)
 
ttgatatgtaattatcgaaatcttcttataagaacaatataccaactcttttctttaataaccctaacaaaaaaaagatacataaatctggtgcatatac  26381000
         --------->ANAC46                                               <----------DOF2
      --------->ARR11(2)                                                <---------DAG2
      --------->ARR14(2)                                                <---------DOF5.7(1)
      <---------ARR11(2)                                             <---------ALFIN1          -----
->ARR11(2)                                                     --------->GATA12               ------
--ARR11(2)                              --------->MYB52(1)     --------->ARR14(2)             ------
->ARR14(2)                           --------->YAB1            <---------GATA12               ------
------>ANAC46                       <---------YAB1             --------->RVE1(2)         --------->REM1(1)
---->ANAC46              ------------>CBF  ----------->GT1  ------>ZmHOX2a(1)            --------->ANAC46
--ARR14(2) <---------CCA1(2)    <---------RVE1(2)  --------->YAB1 --------->ANAC46       --------->ZAT6
 
acatctctctatccgtctctctctgggtttcaatggattatgaaaacggagaaataatagctcctaaatccaccactttatgggatagacttacaccacg  26381100
                       <---------ANAC46
                       <---------ANAC58
                  --------->ALFIN1
                 ------->MYC3
                 ------->MYC2
                <---------O2
                <---------ANAC55(2)
                ==========================================MYC_MYB
                <---------ANAC46                             <---------YAB5                     ----
                --------->O2                                 <---------TOE2(3)                  ----
                <---------ANAC58                           --------->YAB1                       ====
   --------->DAG2<-------MYC2                              --------->ATHB51                     <---
  --------->DOF5.7(1)  <---------ANAC58                   --------->ICU4                        ----
  ========================bZIP_DOF                 --------->At4g35610                          <---
  ---------->DOF2<-------MYC3                     ------->GAMYB                          --------->ANAC58
------>RAV1(1)  --------->ANAC55(2)              --------->MYB46(3)                      --------->ANAC58
--->ANAC58      --------->TGA1a                --------->ARR11(2) --------->KAN1    <---------At4g35610
--->ANAC58      <---------ANAC58               <---------ARR11(2)--------->ARR11(2) --------->At4g35610
--->ANAC46      <---------TGA1a       ------>ZmHOX2a(2)  --------->WOX13(2)       --------->YAB1<---
 
acaaaaaaagtatgtgttcacgtgtgtcttggtttttttgatcgctatcgcaaccgctgcaattatcgtttatgcctactctgaatcagcacaagaacga  26381200
                                                   <-----------GT1
                                                <---------YAB1
                                               <---------AHL20(1)
                                               --------->AHL20(1)
                                               <---------AHL25(2)
                                               --------->AHL20(2)
                                               --------->AHL25(2)
                                               <---------AHL20(3)
                                               --------->AHL20(3)
                                               <---------AHL20(2)
                                              --------->YAB1
                                             <---------YAB1
                                           <---------KAN1
       <---------------------WRI1          --------->KAN1
    --------->DOF5.7(1)                    <---------RVE1(1)
   --------->DOF5.7(1)                    <---------RVE1(2)
   --------->MYB52(1)                     --------->ARR14(2)
----->O2                                  <---------ARR11(3)                  <---------WOX13(2)
------->GT1                               <---------ARR11(2)                  --------->WOX13(2)
======================bZIP_DOF            <---------ARR14(2)               ------>ZmHOX2a(1)
------ANAC46                              --------->ARR11(2)              --------->TOE2(3)   <-----
----->TGA1a                             --------->LBD16            <-----------GT1   ------->GAMYB
------TGA1a---------->DOF2            <---------LBD16           <---------GLK1(1) <-----------GT1
------O2<---------ANAC46             ------->TEIL--------->YAB1<---------GATA12--------->WOX13(2)
 
cgtgaaaaacggcgtaaagaacaacgtatagaaaactatgcaccggatattataataccatctatggatttcacagtccttaatttaaccgagactagtc  26381300
                                          ------>ZmHOX2a(1)
                                          --------->LBD16
                                     ------>ZmHOX2a(2)
                                    <------ZmHOX2a(2)
                                    =============HOX2a_HOX2a
                                   --------->ARR11(2)
                                   <---------ARR11(2)
                                   --------->GATA12
                                   <---------GATA12
                                   <---------ARR14(3)
                                   --------->ARR14(3)
                                   <-----------ARR10
                                   --------->ARR14(2)                            --------->YAB1
                                   <---------RVE1(2)                 --------->CCA1(2)
                                   --------->AGP1                   <---------ARR14(2)
                                   <---------ARR11(3)               --------->ARR14(2)
           <---------RVE1(2)       <---------ARR14(2)               --------->GATA12               <
           --------->GATA12        <---------GLK1(2)                <---------GATA12            ----
<---------ZAT6   <---------YAB5    --------->ARR11(3)               <---------RVE1(2)      ---------
----------->GT1  <---------ZAT6   <---------CCA1(2)               ----------->ARR10   <----------DOF2
----ZAT6   <---------GATA12   <-----------HVH21              ---------->DOF2  <----------DOF2-------
 
ttagtgttaaatgggatttagtgatcaggcttccttcagatcttcctggttactatatgtgtctcaaaggagatttgcagactttcatactttacaaagg  26381400
                                                                                                <---
                                                                                                <---
                                                                                               -----
                                                                                               <----
                                                                                              <-----
                                                                                              ------
                                                                                             <------
                                                                                             <------
                                          <---------AHL12(1)                          <---------MYB46(3)
                                 <---------DAG2                                     <---------MYB52(1)
                           --------->ARR11(2)         <----------DOF2             <---------ANAC46
 <---------YAB1          ----------->GT1 --------->AHL12(3)                       <---------ANAC58
-----------GT1    ------>ZmHOX2a(1)      <---------ICU4<---------DOF5.7(1)        <---------ANAC58
----->ALFIN1     --------->TOE2(3)       --------->AHL12(1)               --------->WOX13(2) -------
->DOF2    <---------WOX13(2)     <----------DOF2     <---------DOF5.7(1)  <---------WOX13(2)<-------
-->DOF5.7(1)     --------->TOE1(3)       <---------AHL12(1)           <----------DOF2<---------TOE1(2)
 
tgttaccattgctaattcatccttagacaggttacactttttaaaaatttcaatactctttttttttttttttctttaactaatttcgtttgttcatata  26381500
<- Previous    Next ->

AGI:  At1g70020.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G39330.1); contains InterPro domain Protein of unknown function DUF1163 (InterPro:IPR009544)
Range:  from: 26381033    to: 26382022    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version