AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                             --------->ARR14(2)
                                                             <-----------ARR10
                                                             <---------ARR11(1)
                                                             ------->TEIL
                                                             <---------ARR14(2)
                                                             --------->RVE1(2)
                                                             <---------ARR11(2)
                  --------->ANAC58                           --------->ARR11(2)
                  --------->ANAC46                          <---------CCA1(2)
                  <---------ANAC55(2)                     <---------ANAC55(2)
                  <---------bZIP60(1)                     <---------ANAC58
                  --------->bZIP60(1)                     <---------ANAC58
                  --------->ANAC55(2)                  <-----------GT1
                  --------->ANAC58                     --------->ARR11(2)
       ----------->HVH21                               <---------ARR11(2)              <---------HSFC1(2)
      <-----------HVH21                              <---------HSFC1(2)                <---------HSFB2a(1)
     --------->ANAC55(2)                 <---------DEAR3(2) <---------ARR14(1)         --------->HSFC1(2)
     <---------ANAC58                    <---------MYB46(3)--------->LBD16             --------->HSFB2a(1)
     <---------ANAC58                  <---------MYB52(1) --------->ANAC55(2)        <---------ARR11(2)
     <---------ANAC55(2)    <------ZmHOX2a(1)   --------->ANAC58            <-------TEIL
 --------->KAN1 <-----------GT1       <-------GAMYB  --------->HSFC1(2)  <---------At4g35610
-----------HVH21--------->KAN1   --------->ZAT18--------->ANAC58         --------->At4g35610  ------
 
agtgtcatgcgtgacagagttacgccatggaggaagtccaccgttggctcgaagcaagtttccgtatctagtcttgagcttcattttggaaccttctctc  26327900
                                                                            --------->MYB46(3)
                                                                          --------->ARR11(2)
                                                                          --------->ARR14(2)
                                                                          <---------ARR14(2)
                                                                          <---------ARR11(2)
            --------->ANAC46                                             --------->MYB46(3)        -
       --------->ANAC46                                            --------->LBD16                 -
     <---------ALFIN1                                          --------->ARR11(2)                  <
  --------->PCF2 <------ZmHOX2a(1)                             <---------ARR11(2)                  -
 <---------ARR14(2)                                  <---------ANAC58   --------->ANAC58          <-
 --------->ARR14(2)                                  <---------ANAC58   --------->ANAC58        ----
 --------->ARR11(2)                              <----------DOF2 <------NtERF2               -------
 <---------ARR11(2)                              <---------DAG2<---------PCF2    --------->KAN1<----
----->HVH21<---------LBD16                       <---------DOF5.7(1)--------->ANAC46        <-------
 
accggttcccactctacggaggagtcgagtcgagccggtttagacaagaccactttacgtccagtggctccgagcaagaaccgctcattcgaagcggtga  26328000
                                               --------->DEAR3(2)
                                              --------->MYB52(1)
                                              ------->TEIL
                --------->TOE2(3)            <---------ARR14(2)
            <---------ZAT2                   <---------ARR11(2)
   <---------DOF5.7(2)                       --------->ARR14(2)
   <---------At5g28300                     --------->ANAC58
  <-----------GT1                          --------->ANAC46
-------->MYB46(2)================HOX2a_HOX2a --------->ARR11(2)                             <-------
-------->MYB111(1)                         <---------MYB52(2)                               <-------
---------MYB46(3)------>ZmHOX2a(1)      --------->MYB46(3)                               ------>ZmHOX2a(1)
-------->MYB111(2)                    <---------ARR11(2)                           --------->YAB5
-------P    --------->ZAT2            --------->ARR11(2)                          --------->MYB46(3)
-------->MYB.PH3(2)       <------ZmHOX2a(2)--------->ANAC58                     --------->ARR14(2)
-->ALFIN1   --------->At4g35610       <---------ARR14(2)  --------->ANAC58      --------->ARR11(2)
-----AtMYB61<---------At4g35610       --------->ARR14(2)  --------->RVE1(2)     <---------ARR11(2)
----HVH21<---------At4g35610     ---------->DOF2          --------->ANAC58   --------->ETT(1)      <
 
ggtagttaccgtagcagctccttaaacggatcacttcaaaggaaccacgaaccggctcgacaatccatctagctctcttgtcggaaccattcctgtcttg  26328100
                     --------->LBD16
                     <---------At4g35610
                     --------->At4g35610        <---------ANAC55(2)
                --------->KAN1                  --------->ANAC55(2)
            ---------->ID1          <---------YAB1            <----------DOF2
          --------->TOE1(1)         <---------YAB5       --------->RAP2.6(3)
     <---------ARR14(2)         --------->ANAC55(2)      --------->SPL7(1)
     <---------ARR11(2)      <---------RVE1(2)  --------->ANAC58
     --------->ARR14(2)  <---------MYB52(1)  --------->ARR11(2)
     --------->ARR11(2) <-----------HVH21    <---------ARR11(2)                 --------->RVE1(2)
    <---------MYB52(1) <----------DOF2       <---------MYB52(1)       --------->ATHB12
<---------At5g28300--------->MYB46(3)--------->YAB1     --------->MYB52(1)    --------->DOF5.7(1)
--ANAC58  --------->TOE2(1)  <---------GLK1(2)  --------->ANAC58   <---------ANAC58
--ANAC58 ------>ZmHOX2a(1) --------->MYB59------->TEIL ------>ZmHOX2a(1)<---------WOX13(1)   -------
-----------GT1 ------>ZmHOX2a(1)<---------ANAC55(2)------->TEIL    <---------ANAC58  <xxxxxxxxxxxxxx
 
agtcaccgtttcctcgtcctcatccgctgttagatacttatcatggacgttacgcatccttacggctttagcttgattgaaaaaatccatcttctaatac  26328200
                                                                                             -------
                                                                               <------MYB46(1)
                                                                               <------MYB83 <-------
                                                                               <---------ANAC58
                                                                               <---------ANAC46
                                                                               <---------ANAC58
                                                                              --------->MYB46(2)
                <---------ANAC58                                           --------->ATHB12<--------
                <---------ANAC58                                     --------->ANAC58     <---------AHL20(2)
   <---------ARR14(2)                                                --------->ANAC58    --------->AHL20(2)
   --------->ARR11(2)                                        <---------TOE2(3)*TSS       --------->AHL25(3)
   --------->ARR14(2)                                      --------->AHL25(3) <---------AtMYB61
   <---------ARR11(2)                   <---------DOF5.7(1)--------->AHL25(1) <---------MYB46(3)
-->ZAT6      <----------DOF2           <----------DOF2     <---------AHL20(2) --------->MYB111(1) <-
xxxxxxsmallRNA(le3)  <---------REM1(1)<---------DOF5.7(1) <---------KAN1  --------->ICU4 --------->ICU4
 
tatgcgaatactatttctttcttgttgaagcttaagaagtgtctttttttgcacaagacgaattaatgtggaatgcaatgtttggtgttgtatttattat  26328300
                              --------->ALFIN1
                            --------->TGA1a
                            <---------ANAC58
                            <---------O2
                            <---------TGA1a
                            --------->O2
                            <---------ANAC58
                            <---------bZIP60(2)
                            <---------ANAC55(1)
                         ----------->TGA1
                         ----------->HVH21
                         <---------MYB52(1)
                        <-----------HVH21
                       <---------ANAC58
                       --------->DEAR3(1)
                       --------->TGA1a
                       <---------ANAC46
                       --------->O2
                       <---------ANAC58
                       <---------O2
                       <---------TGA1a
                      <------NtERF2
                    <---------DEAR3(1)
                   --------->ZAT14
                   --------->ABI4(2)
                   --------->SPL7(1)
                   <---------ZAT14
                  <---------ATERF1(1)
                  --------->ALFIN1
-->YAB1    ======================bZIP_DOF
--YAB1     ---------->DOF2  <---------ANAC46                                                       <
-AHL12(2)  ===========================bZIP_DOF                           <---------AHL20(2)        -
-----ZmHOX2a(1)<---------DEAR3(1)                                      <---------YAB1  --------->O2<
 
aggagacttaagtccaaagcggtgcgccgtgacgtggacattttctcagtcgtttattttgaattcatccaagtattatatgatatagccatgtgatgaa  26328400
                                      <---------ANAC58
                                      <---------O2
                                      <---------bZIP60(2)
                                      --------->O2
                                      <---------ANAC58
                                      <---------ANAC46                <---------At4g35610
                                      --------->ANAC55(2)             --------->At4g35610
                                      <---------TGA1a               <-----------bZIP910(2)
                                      <---------ANAC55(1)          --------->TGA2(2)
                                  <---------WOX13(1)              <-----------TGA1
                                 <---------WOX13(2)               <-----------HVH21
                              ==================bZIP_DOF         <---------TGA1a                 ---
                         <---------ANAC58         ------>MYB46(1)--------->ANAC46          ---------
                         <---------ANAC58         ------>MYB83   <---------O2          <---------ICU4
           --------->ANAC58   =============================================bZIP_DOF    --------->YAB5
           --------->ANAC58   <----------DOF2<-----------GT1     --------->ANAC58      --------->YAB1
 ------>ZmHOX2a(2)   --------->DAG2  ----------->STF1            --------->ANAC58      <--------HAHB4
<------ZmHOX2a(2)    --------->DOF5.7(1)--------->ALFIN1         --------->TGA1a      <---------YAB1
---------GATA12 --------->AtLEC2 --------->WOX13(2)              --------->bZIP60(2)  <---------YAB5
-------->ARR11(3)   ---------->DOF2----------->HVH21             --------->O2     <---------GLK1(2)<
---------ARR11(3)   ============================bZIP_DOF    <-----------GT1       <---------RVE1(2)-
 
acgatcttagccactagccatggaaaagtcgtgcttaattgacgtgtttcaccaaattttgtttttccacgtcagcatccatatagattatcattatctg  26328500
                                                                                            <-------
                                                                                         <---------TOE2(1)
                                                                                         <---------TOE1(1)
                                                                             <---------AHL25(3)
                                                                             <---------AHL20(2)
                                            --------->ARR11(3)              --------->AHL20(2)
                                            <---------ARR11(3)     <---------MYB46(3)   --------->SPL7(1)
                                          <---------TOE2(3)       <----------DOF2     --------->TOE1(2)
                                      <---------WOX13(2)         <---------ANAC46     --------->TOE2(2)
      <-------GAMYB                   --------->WOX13(2)         <---------ANAC58   <---------------AtSPL8
<---------ICU4                    --------->TOE2(3)  <---------AHL20(2)     --------->AHL25(1)
--------->YAB1         --------->DOF5.7(1)<---------TOE1(3)<---------YAB1   <---------AHL20(2)
------>YAB1<---------ARR11(2)    --------->YAB1      --------->AHL20(2)     <---------AHL25(1)
>RVE1(2)   --------->ARR11(2)   <---------YAB1      --------->AHL20(2)----------->GT1 <---------SPL7(1)
---------YAB5        ---------->DOF2 --------->WOX13(1)--------->WOX13(2)  --------->AHL12(2)   <---
-------->ICU4 ------->GAMYB    --------->RVE1(2)  <----------DOF2<---------ANAC58   --------------->AtSPL3
 
taataatcccgttgtaaccgagagaaaagaagagtatcatcaattaaggtctccttttaattctcatcgcttgttgtaaataaatgaaacgtacgatgtt  26328600
                                                                                                 <--
                                                                                         --------->ANAC58
                                                                                         --------->ANAC46
                                                                                         --------->ANAC58
                                                                                       =============
                                                                                       ---------->DOF2
                ----------->GT1                                                --------->ANAC58<----
               --------->DAG2                            --------->DAG2        --------->ANAC58-----
   <---------AHL20(2)  --------->RVE1(2)                ---------->DOF2    --------->ANAC58    -----
 --------->AHL12(2)  <---------YAB1         --------->AHL20(2)      ------->TEIL       --------->MYB46(3)
--YAB1   ----------->GT1    ---------->DOF2 <---------KAN1----------->GT1  --------->ANAC46   ------
------MYB46(3)---------->DOF2     <---------KAN1       <---------KAN1      --------->ANAC58   <-----
 
tgttattttatatagagaaaagttattatccaaaagaatataggtgaataaatgaagaataaagttaaatgtatttgcccgtaagaaacaacaagcgatc  26328700
                                                       --------->ANAC58
      <---------TGA1a                                  --------->ANAC58
      <---------O2                                   <---------ANAC58
      --------->TGA1a                                <---------ANAC58
      --------->O2                                  <<<<<<<<<<FUS3         ----------->GT1
-------YAB1                                         <<<<<<<<<<ABI3      <---------GLK1(1)
================bZIP_DOF                            >>>>>>>>>>FUS3     <---------ARR11(3)
-----ICU4                               --------->ANAC58               --------->ARR11(3)
---->YAB1      <---------PCF2           --------->ANAC58    <------NtERF2  --------->YAB1  <--------
---->YAB5 <---------KAN1  <---------TOE2(3)        --------->AtLEC2---------->DOF2         <--------
--->ICU4  --------->ALFIN1<---------TOE1(3)  --------->AtLEC2  ----------->HVH21         ------>MYB83
-ZmHOX2a(2) --------->ALFIN1            --------->ANAC46   ------>NtERF2--------->GLK1(1)------>MYB46(1)
 
atgagagtcacgagtgtgggactcttcttaaggcttaactcttaagccatgcccatgcatgcccccatgacaaagatatcgtaactaataccaacttttg  26328800
<- Previous    Next ->

AGI:  At1g69890.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G27100.1); similar to unknown [Populus trichocarpa] (GB:ABK94560.1); contains InterPro domain Protein of unknown function DUF569 (InterPro:IPR007679); contains InterPro domain Actin-crosslinking proteins (InterPro:IPR008999)
Range:  from: 26326774    to: 26328279    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version