AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                          --------->ATHB12
                                                                                          <---------ICU4
                                                                                          <--------HAHB4
                                                                                         <---------YAB5
                                                                                         <---------ATHB12
                                                                                 --------->ARR11(3)
                                                                                 --------->ARR14(2)
                                                                                 <---------ARR11(3)
                                                                                 --------->RVE1(2)
                                                                                 <---------ARR14(2)
                                                                                 --------->KAN4(2)
                                                                                <----------TaMYB80
                                                                                --------->KAN4(1)
                                                                                <---------KAN4(1)
                                                                                <---------GLK1(1)
                                                                                --------->KAN1
                                                                <------ZmHOX2a(2)<---------ARR11(2)
                                                               --------->GATA12 <---------KAN1
                                                      --------->TOE2(3)         --------->GLK1(1)
                                                     --------->ANAC58           --------->HSFB2a(1)
     --------->LBD16                                 ----------->GT1            <---------HSFB2a(1)
------>RVE1(2)                                       <---------ANAC55(2)       ---------->TaMYB80
-------ARR11(3)                                      --------->ANAC58  <-------TEIL --------->TOE2(3)
--->TOE2(3)                 ------->TEIL             --------->ANAC55(2)       <---------KAN4(2)
-->RAV1(1)          <---------ZAT2                <---------ARR11(2) <---------ARR11(2)  --------->ICU4
 
tatctctccagagatgaagtccaagctcatgaacatgagttttcttagtagtagaaacgtaagtacgatccatatacatgagaatatccctaatcatttg  26207700
              --------->KAN4(2)
             <---------ICU4
             --------->YAB5
             --------->KAN1
            <---------YAB1
            <---------YAB5                                                              <---------At4g35610
           --------->ARR11(3)                                                      <----------DOF2
           <---------ARR11(3)                                                 <---------ARR11(3)
          --------->YAB1                                                      --------->ARR11(3)
         --------->ICU4                                                       --------->RVE1(2)
         <---------YAB1       --------->ANAC58           <---------At4g35610 <---------CCA1(2)
         <---------YAB5       --------->ANAC58    ------>ZmHOX2a(1)        --------->ANAC55(2)
  <----------DOF2        ------>ZmHOX2a(1)       <---------ALFIN1 --------->WOX13(2)    --------->At4g35610
 
caacgctttgttatgatcattccatttcctattaagcaattctaaaaatgctcctccttgagcttcttcaatagacttacatatctctttgagatgaaat  26207800
                                                               --------->ARR11(2)
                                                               <---------ARR14(2)
                                                               <---------ARR11(2)
                              <-----------GT1                  --------->ARR14(2)
                ----------->GT1                             <---------ANAC58            --------->At4g35610
              --------->ZAT18 --------->YAB1                <---------ANAC58   --------->AtMYB61
    ----------->GT1         --------->RVE1(2)           --------->KAN1     <----------ID1
   <---------ZAT6    ---------->DOF2          <---------ARR11(2)       --------->KAN1   <---------At4g35610
 
gtcatagtggtaacaagtccagtataaagcttatcaccatacttatgtagaaccatgttgtatgcgtttctgaaataagcgaccaaagtttagcagaaca  26207900
                                                <---------ARR11(3)                   <---------GATA12
                                      ------->TEIL                                   --------->GATA12
                        --------->GATA12        --------->ARR11(3)                   --------->RVE1(2)
                       --------->GLK1(1)    ---------->DOF2                 <---------YAB1
                ---------->DOF2     --------->ZAT18                         <---------YAB5         <
               --------->YAB1       <---------ZAT18                    <---------ANAC58       ------
             ------->TEIL          --------->ALFIN1                    <---------ANAC58    <--------
        --------->CCA1(2)         --------------->AtSPL8        --------->ZAT18 ----------->GT1    <
 
acaacaacaagagatgaatcaaagtgaaatctatggaagtgtacctgtaaagctcttcgaaactgagaccactagcgttgtgattgtaaatctcatgaat  26208000
           ------>ZmHOX2a(2)
          <------ZmHOX2a(2)
          --------->HSFB2a(1)
          <---------KAN1
          <---------HSFB2a(1)
         <---------RVE1(2)
         <---------ARR11(3)
         --------->ARR11(2)
         --------->ARR14(3)
         <-----------ARR10                     --------->YAB5
         <---------ARR14(3)                    ------>NtERF2
         --------->ARR11(3)                 --------->YAB5                   --------->HSFB2a(1)
         <---------ARR14(2)                --------->MYB46(3)                <---------HSFC1(2)
         --------->ARR14(2)             <---------WRKY12                     --------->HSFC1(2)   <-
         <---------ARR11(2)            <------ZmHOX2a(2)             <---------GATA12            <--
<---------KAN1                        <---------GATA12               --------->GATA12     <---------YAB1
---------TOE2(2)                      --------->GATA12  <---------ANAC46     <---------HSFB2a(1) <--
->TEIL   <---------GATA12      <---------ARR14(2)       <---------ANAC58 ----------->GT1<---------At4g35610
-YAB1    --------->GATA12      --------->ARR14(2)       <---------ANAC58<---------HSFB2a(2)      ---
---------TOE1(2)            <---------ANAC46------->GAMYB<----------DOF2--------->HSFB2a(2)---------
 
cgcatgttcaaggatcttccaagttttatcggcgtattttggatcaacgacgactcgttgcttaaacgcttcaatctggaaatttctcttcttctgatta  26208100
                                                                                     <---------ICU4
                                                                                     --------->YAB1
                                                                                     --------->YAB5
                                                                                 --------->AHL25(1)
                                                                                 <---------AHL25(3)
                                                                          <---------LBD16
                                                                          <---------HSFB2a(2)
                                                                     --------->AHL12(1)
                                                                     --------->KAN1 <---------ATHB12
                                                                    --------->AHL25(1)
                                                                    <---------AHL25(1)
                                                                    <---------AHL20(3)    <---------YAB1
                                                                    --------->AHL25(2)  <---------ICU4
                                                                    --------->AHL12(1)  --------->YAB5
                                                                    <---------AHL25(2)  --------->YAB1
                                                               ----------->GT1   <---------AHL12(1)
                                                            --------->RVE1(2)    --------->AHL12(1)
                                                            --------->GLK1(2)    <---------AHL20(2)
--------ICU4                                                <---------GATA12    <---------KAN1
-------YAB5                                            ----------->GT1    --------->HSFB2a(2)
-------------AGL15            --------->DOF5.7(1)   ---------->DOF2 --------->AHL20(3) --------->ICU4
------------>AGL15      ---------->DOF2         --------->At4g35610 <---------AHL12(1) <---------YAB1
>YAB5        ------->TEIL--------->DAG2     --------->RVE1(2) ----------->GT1<------ZmHOX2a(1)
 
ctcattgttgaaaatgaaactgaaccaaaaagtaagagagaccacaaaatcagttcaaaggaaaatcggaaaaaattcgaggaataaatcatgatgatag  26208200
                                                                                                   -
                                                                                                   <
                                                                                                   <
                                                                                                 ---
                                                                                                 ---
                                                                                                <---
                          <---------TOE1(2)                                                     ----
                       --------->YAB1                                                         ------
            --------->TOE2(3)                                                                 ------
            --------->TOE1(3)                                                                -------
            --------->TOE1(2)  --------->YAB1                                                <------
   --------->ATHB12 --------->WOX13(1)         <---------TOE1(3)     <---------TOE2(3)     ---------
   --------->YAB5 ------------>CBF             <---------TOE2(3)     <---------TOE1(3)     ---------
  --------->ICU4  <------ZmHOX2a(2)       <---------MYB46(3)    <---------KAN1            --------->ICU4
<------------CBF --------->GATA12   <------------CBF           --------->GLK1(2)        --------->YAB5
 
aagaattgattaaaaccttagatcaatcgtagaatcagaaattggaggttagggtttgtgatgaagaatttgaaggttgaagtcttgaagacgatgatga  26208300
                                         --------->AHL20(3)
                                         <---------AHL25(2)
                                         <---------AHL20(3)
                                        <---------ICU4
                                        --------->YAB1
                                       <---------YAB1
                                       --------->ICU4
                                   --------->TOE2(3)
                                 <---------GATA12
                                 <---------ARR11(3)
                                 --------->ARR11(3)
                               <---------AHL25(3)
                               <---------AHL20(2)
                              --------->AHL25(2)
                              --------->AHL20(2)
                              <---------AHL25(1)
                              --------->AHL25(3)
                              <---------AHL20(2)
                              --------->AHL12(3)
                              <---------AHL12(3)
                              --------->AHL25(1)
                            <---------AHL12(2)
                          <---------AHL20(2)
                          --------->AHL25(2)
                          --------->AHL12(1)
                          <---------AHL12(3)
                          --------->AHL20(2)
      --------->ICU4      <---------AHL12(1)
    --------->YAB1        --------->AHL20(1)
  <---------WOX13(1)      --------->AHL25(1)
--------->YAB5            <---------AHL25(1)
--------->ATHB12          <---------AHL25(2)
-------->ICU4             <---------AHL25(3)
---------YAB1             --------->AHL25(3)
---------YAB5            <---------AHL25(1)
------>YAB1              <---------AHL12(3)
------>YAB5              --------->AHL25(2)
------YAB1               --------->AHL20(2)
----->ICU4    --------->At4g35610--------->GATA12
--->YAB5      <---------LBD16 <---------AHL25(3)                --------->ZAT6
--->YAB1 <---------YAB1  --------->AHL12(3)                   <---------ARR11(3)
-->ICU4--------->YAB1    --------->AHL25(1)                   --------->RVE1(2)
---YAB1--------->YAB5    <---------AHL25(2)                <---------RVE1(2)
>YAB5 <---------YAB1     --------->AHL25(3)         <---------MYB46(3)
>YAB1<---------TOE2(3)  --------->AHL12(2)<---------YAB1 <---------YAB1               ----------->GT1
 
tgatgattgatgatgatagcggaagaaaaaaaattaaatcttattattatcccagtggttttgattatctctatttgtttaaaatgggctagataaaaca  26208400
                                                  <---------ANAC58
                                                  <---------ANAC46
                                                  <---------ANAC58
                                              <-----------HVH21
                                        <-----------GT1
                                      <---------AHL20(2)
                                   <---------WOX13(2)
                                   <---------AHL12(2)
                                   --------->WOX13(2)
                                  <---------AHL20(2)
                                  --------->AHL20(3)
                                  --------->AHL20(2)          --------->KAN1               <--------
                                  <---------AHL20(3)         <---------YAB1                ---------
                                  <---------AHL25(3)      --------->ICU4        <---------ARR14(2)
                                 --------->AHL20(2)     --------->KAN1          --------->ARR14(2)
                                 <---------AHL20(2)  ----------->GT1       ----------->GT1 ---------
            ----------->GT1      --------->AHL25(1)  <------MYB46(1)       --------->YAB1  <--------
         <----------DOF2         --------->AHL25(3)  <------MYB83  *TSS   <---------ATHB12--------->ALFIN1
 
gatgggcctgggcttttgttaaaaaaaactacggtattaatttaaacgatgtcgcttggtaattctcattcttctcaatcgtgaatttgcagagtgcaga  26208500
                                                                          --------->ANAC46
                                                                          --------->ANAC58
                                                                          --------->ANAC58
                                                <---------WOX13(2)      ---------->DOF2
                                            <---------MYB52(1)       <-----------HVH21
                                           <----------DOF2          --------->ANAC58
                                      <---------ANAC58              ================================
                                      <---------ANAC58              --------->ANAC58
                                  <---------WOX13(2)                ===============bZIP_DOF
     <---------WOX13(1)   ---------->ID1   ===================================bZIP_DOF
    <---------WOX13(2)  --------->MYB52(2)<---------ANAC58          --------->TGA1a               <-
   --------->ATHB12    <---------TOE1(2)  <---------ANAC58          <---------bZIP60(1)    ---------
  <---------YAB1      <---------MYB52(1)  <---------ANAC46          <---------TGA1a  <----------DOF2
-ZAT14             <---------YAB5 --------->WOX13(2)                --------->bZIP60(1)   <---------RVE1(2)
>ZAT14             <---------ATHB12<---------YAB5  ===========================bZIP_DOF    <---------GLK1(2)
>ZAT18       --------->ANAC58   <---------AHL20(2) ---------->DOF2  ============================bZIP_DOF
-ZAT18       --------->ANAC58   <---------YAB1  --------->WOX13(2) --------->SPL7(1)<---------DOF5.7(1)
 
cattgttgattgaagaacgctaatcgtttgtttttttaattgtttgcgttaagttaaagctacttgttgggacgtcaaagcaacgcttctttcgattctg  26208600
<- Previous    Next ->

AGI:  At1g69670.1   
Description:  ATCUL3B/CUL3B (Cullin 3B); protein binding / ubiquitin-protein ligase. similar to ATCUL3/ATCUL3A/CUL3/CUL3A (Cullin 3A), protein binding / ubiquitin-protein ligase [Arabidopsis thaliana] (TAIR:AT1G26830.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN81888.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO48405.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN72935.1); contains InterPro domain Winged helix repressor DNA-binding (InterPro:IPR011991); contains InterPro domain Cullin homology; (InterPro:IPR016158); contains InterPro domain Cullin repeat-like (InterPro:IPR016159); contains InterPro domain Culli
Range:  from: 26205694    to: 26208105    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g69680.1   
Description:  similar to unknown [Populus trichocarpa] (GB:ABK93471.1); contains InterPro domain Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124); contains InterPro domain Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); contains InterPro domain Ran-interacting Mog1 protein (InterPro:IPR007681)
Range:  from: 26208468    to: 26210591    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version