AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                <---------ANAC58
                    ------>MYB83                                                <---------ANAC58 <--
                    ------>MYB46(1)                                 --------->TOE2(3)         <-----
---------MYB52(1) <---------MYB59                                   --------->TOE1(3)<---------WOX13(1)
 
ccattacttctacatactataccaaattcaaaatttagaactacctattttgtagactaaaactttctcaagcttaaattgtttcttgatagactaaata  26145100
           --------->DAG2
          ---------->DOF2
---->AHL20(2)
---->AHL25(1)
---->AHL25(2)
-----AHL20(2)
-----AHL20(1)
-----AHL20(3)
---->AHL20(3)
---->AHL12(1)
-----AHL25(1)
---->ARR11(3)
-----AHL12(1)                                  --------->AHL20(3)
-----AHL25(3)                                  <---------AHL20(3)
-----AHL25(2)                                  <---------AHL12(3)                       ------->MYC3
---->AHL25(3)                                  --------->AHL25(1)                       <-------MYC3
-----ARR11(3)                                  --------->AHL20(2)                    --------->TGA1a
---->AHL20(1)                           <------NtERF2                                <---------TGA1a
--->AHL12(1)                            ----------->RAV1(2)                          ===============
----AHL12(3)                           <---------ATERF1(1)    --------->ANAC46       ===============
--->AHL12(3)                           ------>NtERF2          --------->ANAC58       ===============
----AHL12(1)                          <---------RAP2.6(2)     --------->ANAC58    <---------ZAT18
--->AHL20(2)                         --------->RAP2.3(1)    --------->ANAC46    --------->At4g35610
-------AHL12(2) <------MYB46(1)      --------->ATERF1(1)  --------->AtMYB61     <---------At4g35610
----AHL25(1)    <------MYB83        <---------ATERF1(1)<-----------GT1         ------->TEIL  <------
 
tattatcccaaggtaaagttggtgtttatgtgtgtttgaaggcgcctgaaaaaaatagaaaccacacgactcgtcttgtatgtagctcacatgtgtcttt  26145200
                                                                  <---------AHL12(2)
                                                                 <---------AHL20(2)
                                                                 --------->AHL12(3)
                                                                 <---------AHL12(3)
                                                                 <---------AHL12(1)
                                                                 --------->AHL12(1)
                                                                 --------->AHL12(2)
                                                                 <---------AHL12(2)
                                                                --------->AHL25(1)
                                                                <---------AHL25(1)
                                                                --------->AHL20(1)
                                                                <---------AHL20(1)
                                                                <---------AHL20(2)
                                                                --------->AHL20(3)
                                                                <---------AHL20(3)
                                                                --------->AHL20(2)
                                                                --------->AHL25(2)
                                                                <---------AHL25(3)
                                                                <---------AHL25(2)
                                                                <---------AHL12(1)
                                                                <---------ARR11(3)
                                                                --------->ARR11(3)
                                                                --------->AHL12(1)
                                                                --------->AHL25(3)
                                                               --------->AHL12(2)
                                                               --------->AHL12(3)
                                                               --------->AHL20(2)
                                                               <---------AHL12(3)
                                                               <---------AHL12(2)
                                                               --------->AHL12(1)
                                    --------->At4g35610        <---------AHL12(1)
                                    <---------At4g35610       --------->AHL12(2)
                             <---------ARR11(3)               <---------AHL12(2)
                           <---------AHL25(3)                <---------AHL20(3)
                           <---------AHL20(2)                --------->AHL12(3)
                          --------->AHL20(2)                 <---------AHL12(3)
                          <---------AHL25(1)                 --------->AHL20(3)
             --------->ANAC58--------->ARR11(3)            --------->AHL25(2)
      <----------DOF2    --------->AHL12(2)                <---------AHL20(3)
      <---------DAG2   --------->AHL12(1)                  --------->AHL20(3)                  <----
     <---------ANAC58  <---------AHL12(1)                  <---------AHL12(3)                  <----
     <---------ANAC58<---------AHL12(2)                    --------->AHL12(3)                 ------
 <----------DOF2     --------->AHL12(2)                    --------->AHL20(2)                 ------
<---------DOF5.7(1)--------->AHL20(2)   <----------DOF2   --------->AHL20(2)                  ------
=================bZIP_DOF<---------AHL12(2)            --------->YAB1<---------AHL20(2)    ---------
====bZIP_DOF --------->ANAC58--------->GATA12       ----------->RAV1(1)       --------->KAN1  ------
============bZIP_DOF<---------AHL20(2)  <---------ARR14(2)--------->YAB1 <-----------GT1   ---------
----DOF2     --------->ANAC46<---------GATA12  --------->PCF5--------->AHL20(2)            <--------
 
gcctctttgctttttcatgccattaaatattaaatcttcagcggtttttggtccccaacaataaaaatatattttcttactatattctatagttcattaa  26145300
                                               <---------AHL20(2)
                                               <---------AHL25(1)
                                               <---------AHL12(3)
                                               --------->AHL25(2)
                                               <---------AHL25(3)
                                               <---------AHL25(2)
                                              --------->AHL25(3)
                                              <---------AHL25(3)
                                              <---------AHL25(2)
                                              --------->AHL25(1)
                                              --------->AHL20(1)
-----TOE2(3)                                  <---------AHL20(2)
-----YAB1                                     --------->AHL20(2)
--->YAB1               --------->AHL20(2)     <---------AHL20(1)                            --------
--->AHL12(3)           <---------AHL20(2)     --------->AHL12(3)                            --------
--->AHL20(2)   ------>MYB46(1)                <---------AHL12(3)                           ---------
>WOX13(2)      ------>MYB83           ----------->GT1                                      ---------
--->AHL20(3) <---------MYB59       ------------------------>ANAC81                    ----------->GT1
>TOE2(3)<---------KAN1--------->AHL12(2)      <---------AHL25(1)               ---------->DOF2 -----
-WOX13(2) <-----------GT1    <---------YAB1   --------->AHL25(2) <---------AtMYB61  ---------->DOF2
 
tattacattgaataaacctaatgttttttaatatgaaaaaccagaaaaataaaattgcattcggagttttggtcttgttttgaaaagaaaagaaaaaagt  26145400
                                                                  <---------WOX13(2)
                                                                  <------------CBF            ------
                         ----------->GT1 --------->WOX13(1)       --------->WOX13(2)         <------
                   <<<<<<<<<<<<<<<<<LFY --------->YAB5          --------->AHL20(2)        <---------DOF5.7(1)
->DAG2           --------->AHL20(2)    <---------ATHB12      --------------->AGL15       <---------DOF5.7(1)
->DOF5.7(1)    --------->TOE1(3)       <---------YAB5        <---------HSFB2a(2)         <----------DOF2
->DOF2         --------->TOE2(3)  --------->TOE2(3)          --------->HSFB2a(2)         <---------DAG2
>DOF5.7(1)   <---------YAB1      ----------->GT1--------->YAB5 ----------->TBP  <---------ALFIN1  *TSS
---->ALFIN1  <---------TOE2(3)   <---------ANAC55(2)         <---------------AGL15  ------>ZmHOX2a(1)
 
ggaagctagttgcattaacattaaacagtggcaaaaacgtaaatcattcactcactaagtttttctataaattgaactactcccctcctctgctttttcc  26145500
                           --------->YAB1
                           <---------ICU4
                          <---------YAB5
                        <---------ICU4
                        --------->YAB1                                             --------->YAB1
                     --------->YAB1                                          --------->ANAC58
                 --------->GLK1(2)                --------->ANAC46       ------>MYB83
                <---------RVE1(2)            <---------DOF5.7(1)         ------>MYB46(1)
                <---------GATA12            ------>ZmHOX2a(1)         --------->HSFB2a(1)
                <---------GLK1(2)           ============================HOX2a_HOX2a<--------HAHB4
                <---------ARR14(2)        <-----------------AGL1 <------ZmHOX2a(2) <---------ICU4
                --------->ARR11(2)       <-----------GT1        <---------ARR11(3)<---------ATHB12
                --------->ARR14(2)       ---------->ID1         --------->RVE1(2) <---------YAB1
               --------->KAN1           <-----------GT1         --------->ARR11(3)<---------YAB5
           --------->MYB52(1)<---------CCA1(2)<----------DOF2 --------->DOF5.7(1) --------->ICU4
        ------>MYB83<---------YAB1  <----------DOF2  ---------->DOF2  <---------HSFB2a(1) <---------
------>CBF ----------->RAV1(1)     <---------DOF5.7(1) --------->DOF5.7(1)   --------->ANAC46
-----GT1------>MYB46(1)--------->ICU4<---------DOF5.7(1)    ---------->DOF2  --------->ANAC58
 
aattctaaaccaaacaacagattctcataatcatctcttcttttttcctctttacgaaaagaagaaagatcaaaccttccaagtaatcattttctttctc  26145600
                                                                                      --------->DOF5.7(1)
                                                                                    --------->DOF5.7(1)
                                                                                    ---------->DOF2
                                                   --------->WOX13(2)          ----------->GT1
                                           <---------MYB59                --------->ANAC46
                     <---------ZAT6        ------>ZmHOX2a(2)            <---------------AGL15
           --------->KAN1                <---------GATA12  --------->ARR11(2)  <----------ID1
-DOF2    <---------ALFIN1                --------->GATA12  --------->ARR14(2)---------->DOF2
 
tctctcacacacacacattcactagttttagcttcacaaaatgtgatctaacttcatttacctatatgcaggtttacacaaaaagaaaaaagaacgatgg  26145700
                                              <-----------HVH21
                                           --------->ANAC55(2)
                                           =================================MYC_MYB
                                           --------->O2
                                           <---------ANAC55(2)
                                           <---------O2
                                           ===================================MYC_MYB
                                           <---------TGA1a
                                        ----------->HVH21                           --------->ANAC58
                                       <-----------HVH21                            --------->ANAC55(1)
                                       <-----------TGA1                             --------->O2
                                      --------->ANAC46                         <---------ZAT18
                                      <---------ANAC58                         ===============MYC_MYB
                                      <---------bZIP60(1)                     --------->ANAC58
                                      <---------ANAC55(2)                  <---------WRKY45
                                      <---------TGA2(1)                    <---------WRKY38(1)
                                      --------->bZIP60(2)                <-----------HVH21
                                      <---------bZIP60(2)              --------->MYB59
                                      --------->TGA2(1)                <------MYB83 --------->ANAC58
                                      <---------TGA1a                  <------MYB46(1)
                                      --------->ANAC55(2)            =========================MYC_MYB
                                      --------->O2                   --------->ALFIN1
                                      <---------O2                   <--------P------->GAMYB
                                      --------->TGA1a               <-------GAMYB <---------ALFIN1
                                      --------->bZIP60(1)           ==========================MYC_MYB
                                      ======================================MYC_MYB --------->TGA1a
                                      <---------ANAC58           <------ZmHOX2a(1)--------->KAN1
                                      ========================================MYC_MYB
                                      <<<<<<<<<<HY5           <------NtERF2<---------WRKY12        -
                                     <-----------STF1 --------->ARR14(2)<------MYB46(1)<---------ALFIN1
                                     ----------->STF1 --------->ARR11(2)<---------ANAC46           <
                                    <---------TGA2(2) <---------ARR11(2)<------MYB83--------->bZIP60(2)
                                   ----------->TGA1 --------->YAB5<---------AtMYB61 --------->ANAC46
                      ===============================MYC_MYB --------->LBD16  --------->ANAC58     <
      <---------DOF5.7(1)          ----------->HVH21<---------MYB46(3) <---------MYB46(3)--------->KAN1
   <-----------GT1    -------->P   <---------ATHB12<---------ATHB12<---------MYB46(3)  ----------->RAV1(1)
 <-----------HVH21    ==========================MYC_MYB    <---------LBD16--------->WRKY18(1)  <----
 
ctcttgtcaccttcttgtttattgctacccttggagcaatgacgtcacatgtcaatggttacgccggaggaggttgggtcaacgcacacgccacattcta  26145800
               ------>NtERF2
              --------->ANAC46
              --------->ATERF1(2)
              <---------ATERF1(2)
              --------->HSFB2a(2)
              <---------HSFB2a(2)
             <---------LBD16
          <---------ANAC58
        <---------YAB1
   <---------MYB46(3)
  --------->ALFIN1                                                                         ---------
  <---------ANAC46                                                                   --------->TOE2(3)
  <---------AtMYB61                     <---------HSFC1(2)                         ---------->ID1
<---------MYB46(3)                      --------->HSFB2a(1)                        <-----------GT1
--------->MYB55(2)                      --------->HSFC1(2)        ---------->DOF2 <-----------GT1
-------->ALFIN1--------->LBD16    <---------ANAC58             <----------DOF2--------->ARR11(3)
---------DEAR3(1)                 <---------ANAC58  --------->ANAC58          <---------ARR11(3)
---------AtMYB61        ----------->GT1------->TEIL --------->ANAC46          <---------GLK1(2)
-----LBD16<---------ANAC58  <---------KAN1          --------->ANAC58   <----------DOF2<----------DOF2
 
cggtggtggtgatgcttccggcacaatgggtatatttccttgaaccttctctcacaagtcacaaggctttaaagctttcaagatttttcctttaccacaa  26145900
                                                                               <----------CDC5
                                                                            --------->RAP2.3(1)
                                                                            <------NtERF2
                                                                            --------->ATERF1(1)
                                                                           <---------RRTF1(1)
                                                                           <---------RAP2.6(1)
                                                                           ------>NtERF2
                                                                           <---------ATERF1(1)
                                                                           <---------ORA47(2)
                                                                           <---------DEAR4(2)
                                    --------->ANAC58                       <---------RAP2.3(1)
                                    --------->ANAC58                       <---------ERF1
                                    --------->ANAC55(2)                   <---------RAP2.3(2)
                                   <---------LBD16                        <---------DEAR3(1)
                                  --------->CCA1(2)                       --------->DEAR3(1)
                                 --------->ARR14(2)                       <---------RAP2.3(3)
                                 --------->ARR11(1)                       <---------RRTF1(2)
                                 <---------ARR14(2)                       <---------RRTF1(3)
                                 --------->ARR11(2)                      <---------ABI4(1)
                                 <---------ARR11(2)                     <---------ATERF1(1)
                          <---------ANAC46                             --------->ANAC46
                          <---------ANAC58                           <---------ALFIN1
                         <-------TEIL                               ------>MYB46(1)
                        --------->ALFIN1--------->GLK1(1)           -------->P------>NtERF2
                     --------->ALFIN1  --------->ARR11(2)           ------>MYB83                   -
                    <------ZmHOX2a(1)  <---------ARR11(2)         --------->AtMYB61   --------->ANAC46
                 <-----------RAV1(2)<---------ANAC55(2)          --------->DEAR3(2)   --------->ANAC58
             <---------ANAC58    <---------RVE1(2)               --------->MYB46(3)   --------->ANAC58
             <-------GAMYB<---------ANAC58 --------->TOE2(3)   <---------ARR11(2) --------->ANAC58 <
>TOE2(3)     <---------ANAC58 <---------ANAC46                 --------->ARR11(2) --------->ANAC58 <
 
ttcttatgaaattttgggttgcaggaggtgcttgtggatacggaaacctatatagccaaggctatggaaccaacacggcggcgctaagcacggctctatt  26146000
<- Previous    Next ->

AGI:  At1g69530.1   
Description:  ATEXPA1 (ARABIDOPSIS THALIANA EXPANSIN A1). Identical to Expansin-A1 precursor (EXPA1) [Arabidopsis Thaliana] (GB:Q9C554;GB:Q38863); similar to ATEXPA10 (ARABIDOPSIS THALIANA EXPANSIN A10) [Arabidopsis thaliana] (TAIR:AT1G26770.1); similar to ATEXPA10 (ARABIDOPSIS THALIANA EXPANSIN A10) [Arabidopsis thaliana] (TAIR:AT1G26770.2); similar to alpha-expansin 3 [Populus tremula x Populus tremuloides] (GB:AAR09170.1); contains InterPro domain Expansin 45, endoglucanase-like (InterPro:IPR007112); contains InterPro domain Rare lipoprotein A (InterPro:IPR005132); contains InterPro domain Expansin/Lol pI; (InterPro:IPR007118); contains InterPro domain
Range:  from: 26145499    to: 26147159    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version