AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                   --------->ANAC58                                   --------->ZAT14
                   --------->ANAC58                                   <---------ZAT14
      ----------->GT1                                                --------->AtLEC2
     <------ZmHOX2a(2)                                               --------->ALFIN1
    <---------GATA12                                      --------->ARR11(3)------>ZmHOX2a(2)
    --------->GATA12                                     =========================HOX2a_HOX2a<------
    <---------ARR11(3)                                   ==========================HOX2a_HOX2a<-----
    --------->ARR11(3)                                   <------ZmHOX2a(1)--------->RVE1(2)  <------
    --------->RVE1(2) --------->WOX13(1)         <---------MYB52(1)<---------ANAC58      ---------->ID1
-------ANAC58    <---------ANAC58             <---------LBD16      <---------ANAC58  <---------ANAC58
-------ANAC58    <---------ANAC58            ------>ZmHOX2a(1)     <---------ANAC46  <---------ANAC58
-------ANAC46    <---------ANAC46            =====================================HOX2a_HOX2a<------
->RAV1(1)     --------->TOE1(2)         --------->KAN1--------->HSFB2a(2)<---------CCA1(2)  <-------
tcttgaagatcgaaaaacttgcgagcaatctgaagagacagcctcatcctccggtctctaggaccttgagccgtgcagatcttactatgcctgtcccttt  25851800
      <---------DOF5.7(1)                   <---------ALFIN1
 <---------At5g28300              <---------ANAC58
<---------WRKY18(1)               <---------ANAC58
<-----------GT1               <---------ANAC58                                   <------------------
---DOF5.7(1)                  <---------At4g35610                               --------->AtLEC2
----DOF5.7(1)                 <---------ANAC46                           --------->ANAC58
----DOF2           ------->TEIL --------->ALFIN1     --------->KAN1 --------->At4g35610
---DAG2 ------>ZmHOX2a(1)     <---------ANAC58      <---------YAB1  <---------At4g35610           <-
--DOF5.7(1)       <-----------GT1<-------TEIL------->GAMYB <<<<<<<<<TBF1 --------->ANAC58         --
ttttgaccgtccttctccattgaacctcttgtgaggtgcttccatcaacacacttctcattcttcttcttaagctcaagcttcttgcaaaatttccaagg  25851900
                    --------->ARR11(3)                                                    ----------
     ----------->RAV1(1)    <---------At4g35610                                 --------->GLK1(2)
<-------TEIL        <---------ARR11(3)                                          --------->RVE1(2)
---WRI1            --------->REM1(1)                        <---------YAB5      <---------GATA12
--------GATA12 --------->At4g35610                          <-------TEIL   --------->ANAC58       --
------->GATA12 <---------At4g35610                       <------ZmHOX2a(1) --------->ANAC58     ----
agattcaacaacatttgctgctacatcttgctgctgtaacaagaattggtttatcaagaaggattcatcaaaactctcaagaaaatcggaagagaaagga  25852000
 --------->DOF5.7(1)      <---------KAN1
>DOF2         <---------ZAT6                      ---------->DOF2  <---------MYB46(3)      ---------
------->DOF5.7(1)<---------AtMYB61     <---------KAN1   ----------->GT1                  <------ZmHOX2a(2)
------>DOF2   <---------YAB5     <----------DOF2<---------YAB1    <--------P     <---------KAN1  <--
aaagaaggcgaagagtagtgatggtgagaattagggctttgaatgtgagtaatgaaagaaggaaacatggttgtttgatggggaatgaagggatcaaaga  25852100
                                                                <-----------ARR10             <-----
                                                                <---------ARR11(3)            <-----
                                   <-------TEIL                 --------->ARR14(2)       --------->ANAC58
                                 <---------GATA12               <---------ARR14(2)   --------->ANAC58
                                 --------->GATA12               --------->GLK1(2)    --------->ANAC58
                            --------->TOE2(3)       <---------DOF5.7(2)<----------DOF2 ---------->DOF2
                           --------->KAN1           --------->MYB52(1) <---------DOF5.7(1)   <------
                           --------->YAB5        --------->ANAC55(2)   <---------DAG2--------->ANAC46
->DOF2                    <---------YAB5         <---------ANAC55(2)  <---------DOF5.7(1)--------->ANAC58
---------HVH21        ----------->GT1           --------->MYB59<---------GLK1(2)  --------->ZAT14<--
ggtcatagccattggtatctagagaaggaaacattagattcaagagagaaataggtaacgaaaacagaatcttccttttcctttcttcactcaagccctt  25852200
                   <---------ANAC58                                       --------->AHL12(1)
        <---------MYB46(3)                                                <---------ARR11(3)
  *TSS <---------YAB5                                             ----------->GT1
  <---------WOX13(2)      <----------DOF2                     <---------ARR11(3)
 --------->ATHB12  <---------ANAC58     <---------STY1(2)     <---------RVE1(2)<---------AHL20(3)
<-------TEIL    --------->ZAT18    <-------TEIL               --------->AHL20(1)
-----DOF2    <---------ANAC58     <--------P                  --------->ARR11(3)     <--------------
----MYB52(1) <---------ANAC46  --------->DOF5.7(1)        ---------->DOF2 --------->ARR11(3)
---DOF5.7(1) <---------ANAC58---------->DOF2   <------ZmHOX2a(1)<------------CBF    ---------->DOF2
-------MYB46(3) <---------ZAT18<---------TOE2(3) --------->DOF5.7(1)      --------->AHL25(2)
tggttcattagtggttgtgtgtgcttgtgctataaaggttgatagctagaggaagatggacaaaagatattgtagaaaatatttttttaaagtactatat  25852300
                                    <---------ANAC58                    --------->DOF5.7(1)
                                    <---------ANAC58                  ---------->DOF2
                                    --------->ANAC55(2)    --------->AHL20(3)
                                    <---------ANAC55(2)    --------->AHL20(2)
                                    <---------HSFB2a(2)    --------->AHL25(1)
                                    --------->HSFB2a(2)    --------->AHL12(3)
                                    ----------->GT1        <---------AHL12(3)
                                    <---------ANAC46       <---------AHL20(2)
              --------->ANAC46--------->ZAT6  <----------DOF2   ----------->GT1                    <
   <----------DOF2      --------->ZAT6    --------->CCA1(1)<---------AHL25(1)                     <-
-AtSPL8<-----------GT1<-----------GT1--------->LBD16       <---------AHL20(3)   ----------->GT1 ----
gtttttcttttaactatacatcatataactctatcacttccgtaaatatcttttagtactatttaaatagaaataaagagagatggtattttctaatatg  25852400
         <-------GAMYB                     --------->KAN1
        --------->MYB52(2)                --------->ARR11(2)
        <---------MYB46(3)                <---------ARR11(2)
     <------MYB46(1)                  <------MYB83
     <------MYB83                     <------MYB46(1)
    --------->MYB59                 <---------MYB52(1)
<------MYB46(1)                     <--------P   ------>MYB83
<---------MYB46(3)                 <-------GAMYB -------->P     --------->DAG2
<------MYB83                      <---------MYB46(3)      <---------------AGL15        --------->ALFIN1
---------AtMYB61                  <---------DEAR3(2)    <---------At4g35610           --------->ALFIN1
--------WOX13(1)               ------>ZmHOX2a(1) ------>MYB46(1)--------->DOF5.7(1)<-----------RAV1(2)
----->ATHB12          <---------RVE1(2)  <-------GAMYB  --------->At4g35610    ---------->DOF2<-----
gattggttcggtcgttactaatatggattagctccttcggttggggttaccctaccttctgcttcaaaaggttgtccaaaacaaaagcagggggggaaca  25852500
                                   <---------TOE2(3)           <---------WOX13(2)
                                   <---------WOX13(2)          --------->WOX13(2)
                             --------->ICU4                    <---------AHL12(2)
                            --------->AHL12(2)               <---------AHL20(2)
                            --------->AHL20(3)             <---------WOX13(2)
                            <---------AHL20(3)             --------->WOX13(2)
                            <---------AHL25(2)     --------->AHL12(3)
                            --------->AHL25(2)     <---------AHL20(2)
                           <--------HAHB4          --------->AHL20(2)
                           <---------ICU4          <---------AHL25(1)
                          --------->ICU4           <---------AHL25(3) <---------RVE1(1)
                          <---------YAB1           <---------AHL12(3) <---------CCA1(1)
                        --------->YAB1             --------->AHL25(1)<---------ARR11(3)
                 <-------TEIL<---------YAB1     <---------WOX13(2)   <---------RVE1(2)
               --------->GATA12    --------->WOX13(2)     ----------->GT1
      <----------DOF2<----------DOF2  ---------->DOF2    <---------AHL20(2)
 --------->KAN1<---------GATA12--------->AHL12(2) --------->AHL25(3) --------->ARR11(3) <---------AHL20(2)
----KAN1       <---------RVE1(2)<---------YAB1  --------->WOX13(2)  <<<<<<<<<RAP2.2    --------->YAB1
tggctaatgcttttgttagattcactttcattattattaatgaaagttttcaatttatatttagttaatttagatatttcacaaaaactattaaaactat  25852600
        --------->YAB5                    <---------------AtSPL8 <----------DOF2                   <
        --------->YAB1           --------->AHL20(2)        <---------ARR11(2)                     <-
       <---------YAB1          <----------DOF2             --------->ARR14(2)                     <-
    ------>ZmHOX2a(2)         <---------DOF5.7(1)         --------->KAN1                         ---
<---------YAB1        <---------KAN1<---------YAB1 --------->ARR14(2)                --------->YAB1<
aacatgatcgatgataagttttggtatatatcatcttttaatattgtggaacagaatacacatattcgctttgaataacatttactgaacataataccaa  25852700
<- Previous    Next ->

AGI:  At1g68800.1   
Description:  BRC2/TCP12 (BRANCHED2); transcription factor. similar to TCP1 (TCP family transcription factor 3), transcription factor [Arabidopsis thaliana] (TAIR:AT1G67260.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO42083.1); contains InterPro domain Transcription factor, TCP (InterPro:IPR005333)
Range:  from: 25850729    to: 25852203    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version