AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                          --------->KAN1
                                    <------ZmHOX2a(2)              <--------P <---------ANAC58
     ------>MYB46(1)               --------->ARR11(2)            <---------KAN1
     ------>MYB83                  <---------ARR11(2)            --------->ALFIN1
   <---------MYB111(1)             --------->GATA12            <---------ANAC58
   <---------MYB111(2)             --------->ARR14(2)          <---------ANAC58
<---------ALFIN1               <---------ALFIN1                >>>>>>>>CAMTA3 <---------ANAC58
---->ARR14(2)          <-----------RAV1(1)                     --------->ANAC55(2)               <--
-----ARR14(2)       <---------MYB46(3)                         <---------ANAC55(2)           -------
---->ARR11(2)    --------->MYB52(2)--------->RVE1(2)    --------->LBD16 <---------MYB59     --------
---->RVE1(2) --------->ATHB12 <------NtERF2      <---------GLK1(2)--------->REM1(2)         <-------
-----ARR11(3)--------->YAB5  ------>NtERF2      <---------ZAT2 <---------ANAC46         <-----------HVH21
 
tccacacctacttcaacgattagttgttgtggcaccacgatccatagtccgagcttctccccaaacgcgtgttggcctaattcgtggtacctgtcgaacc  25357200
              <---------ANAC58
        --------->MYB46(3)
        --------->HSFC1(2)                                                  <-----------HVH21
        --------->HSFB2a(1)                                             --------->ATHB12
        <---------HSFC1(2)                                              --------->ATHB51
        <---------HSFB2a(1)                                             <---------ICU4
      --------->ARR11(2)                                               <---------YAB1
   --------->HSFB2a(2)                                                 <---------YAB5
   --------->LBD16                                                   <---------ICU4          ------>NtERF2
  --------->LBD16                                                    <--------HAHB4       <---------At4g35610
  <---------LBD16            <---------At4g35610                     --------->YAB5       --------->At4g35610
 ----------->RAV1(2)         ----------->RAV1(2)                     --------->YAB1       ----------
 <---------ANAC46            --------->At4g35610     <---------YAB5 <---------YAB1    --------->ARR14(2)
-------DOF5.7(1)           <---------ALFIN1     <---------KAN1      <---------YAB5    <---------ARR14(2)
>TEIL <---------ARR11(2)<-----------GT1   --------->REM1(2)      --------->ICU4 --------->ANAC58
->ARR11(2)    <---------ANAC46           --------->ALFIN1   ----------->HVH21   --------->ANAC58  --
--ARR11(2)    <---------ANAC58         <---------ANAC46--------->ANAC46--------->ICU4 <-----------HVH21
 
tcttccctggaaccatctcgtgcatttgcaccatctgccatagtgtgtagaatgttatcagccatgacattatcattattgtcactccaggtcccctgcc  25357300
                  <---------YAB1
                  <---------TOE2(3)
                 --------->AHL12(3)
                 <---------AHL20(2)
                 <---------AHL12(3)
                 --------->AHL20(2)
                 --------->AHL20(3)
                 <---------AHL25(2)
                 --------->YAB1
                 <---------AHL20(3)                               ------->TEIL
               --------->AHL20(3)                        <---------AHL25(1)
               <---------YAB1                            <---------AHL12(3)
               --------->AHL25(2)                        --------->AHL20(2)
               <---------AHL20(3)                        --------->AHL12(3)
               <---------AHL20(2)                      <---------AHL12(3)
               --------->AHL12(3)                      <---------AHL20(3)
               <---------AHL12(3)                      --------->AHL20(3)
        ----------->GT1                              <---------RVE1(1)
      <---------ANAC58     <-------MYC2              <---------CCA1(1)
      <---------ANAC46     <-------MYC3             <---------RVE1(2)   --------->GATA12
      <---------ANAC58     ------->MYC2             <---------ARR11(3)  <---------GATA12
  --------->WOX13(2)       ------->MYC3--------->ARR11(3)--------->AHL25(1)            ------>MYB83
  <---------WOX13(2)     ------->TEIL  <---------ARR11(3)<---------AHL20(3)       <-----------GT1
<---------YAB1 --------->AHL20(2)      <---------GLK1(2) --------->AHL20(3)     --------->KAN1
->RAV1(2)     --------->TOE2(3)        <---------RVE1(2) <---------AHL20(2)  <---------RVE1(2)    <-
------->YAB1  --------->YAB1----------->GT1         --------->ARR11(3) --------->ATHB12------>MYB46(1)
 
atcaaaattgagtgtaatattaatattgaacgtgtatatagagattttctaatgagatatttatatatgtagctagattggatatataccatccaagatt  25357400
                                ------>NtERF2
                               <---------ETT(1)
                           --------->ZAT2
                           ------>MYB46(1)
                           ------>MYB83
              --------->ZAT2   --------->DEAR3(1)
              <---------At4g35610
              <---------ZAT2   ----------->HVH21
              --------->At4g35610                ----------->GT1                  --------->HSFB2a(2)
        --------->DAG2    --------->ANAC46--------->At5g28300          <---------O2
       --------->SPL7(1) --------->AtMYB61<------NtERF2 --------->ANAC58          <---------HSFB2a(2)
     <---------SPL7(1)   --------->MYB46(3)----------->HVH21           --------->O2
    <---------ANAC58 <---------ZAT18     <---------MYB46(3)          <---------ALFIN1   <-----------ARR10
    <---------ANAC46 --------->ZAT14    <---------ANAC46--------->ANAC58      <---------KAN1
    <---------ANAC58 --------->ZAT18    <---------DEAR3(1)        --------->AtMYB61    <------ZmHOX2a(1)
--------RVE1(2)      <---------ZAT14    <---------DREB2C(2)     --------->SPL7(1) <---------HSFC1(1)
 
agacatggcgtaaggtaagctgagtacaccagccccgaccatggcggtgacattgtgaaacgcagagtaccaccacttggcatttctagaggatgttatc  25357500
                                            <------MYB83
                                          <--------P<---------WOX13(1)
                                        --------->MYB55(2)
                                        <---------MYB46(3)
            --------->KAN1              --------->ATHB12           <---------DOF5.7(1)             -
     <---------ATHB12       <---------ZAT18 <------MYB46(1)        <-----------------AGL3        <--
    ------>MYB83  <---------At4g35610  <---------TOE1(2)     <-----------GT1                 -------
    ------>MYB46(1)      <---------ANAC46<-------GAMYB   <----------DOF2                ----------->GT1
 --------->MYB46(3)    <----------DOF2------>ZmHOX2a(1)  <---------DOF5.7(1)  <----------DOF2<------
 
ggtaaccaatcgtctacattcttctgctttgtggacgcgtccttggttggagacgattgacttttctccatcttattttggctttgaagaacagaaaaaa  25357600
                                                                                         <----------
                                                                                        <---------ICU4
                                                                                        --------->ATHB12
                                                                                       <---------YAB1
                                                                                       --------->ICU4
                                                                                     --------->YAB1
                                                                                     <--------ATHB1
                                                                                     --------->YAB5
                                                                                     --------->ATHB12
                                                         --------->LBD16             <---------ICU4
                                                         ------>ZmHOX2a(1)          --------->ICU4
        <---------WOX13(2)                             ----------->RAV1(2)          <---------YAB1
        --------->WOX13(2)                          <----------DOF2       <---------ANAC58
     ------------>CBF                              <---------ANAC58       <---------ANAC58
  <---------PCF2                                   <---------ANAC58       <---------ANAC46
-------->ALFIN1                             ------------>CBF            ------->TEIL<---------YAB5
---------RAV1(1)          ---------->DOF2 --------->ANAC58    <------------CBF  ------------>CBF
-->AHL20(2)      <---------YAB1           --------->ANAC58   <------ZmHOX2a(1)----------->HVH21
---AHL20(3)    --------->YAB5 <------ZmHOX2a(1)  <---------ARR11(3)  --------->KAN1 <---------ATHB12
 
atgtgggacacaattagatgatgagaaccaaaaggattcaagagcaaggcaatttctttcctgaggattgaaatgtgccttgtgacaatgattattgcaa  25357700
                                                                                      <---------MYB46(3)
                                                                                      --------->MYB55(2)
                                                                                      --------->MYB52(2)
                                                                                      --------->MYB111(1)
                                                                                    <---------ANAC58
                                                                                    <---------ANAC58
                                                                                   <---------MYB46(3)
                                                                                <------------CBF
                                                                               --------->ATHB12
                                                                               <---------AHL20(2)
                                                                               <---------AHL25(3)
                                                                              --------->AHL25(3)
                                                                              <---------AHL25(2)
                                                                              <---------AHL20(1)
                                                                              --------->AHL25(1)
                                                   <---------AHL12(3)         --------->AHL20(1)
                                                   <---------AHL20(3)         --------->AHL25(2)
                                                   <---------AHL20(2)         <---------AHL25(1)
                                                   --------->AHL20(3)         --------->AHL20(2)
                ------------>CBF                   --------->AHL12(3)         <---------AHL20(2)
               <-----------GT1                   =================================MADS_MADS
           ----------->TBP                       <---------------AGL15        <---------AHL25(3)
         --------->AHL20(2)                  <-----------TBP                  <---------AHL20(3)
         <---------AHL25(1)              ---------->ID1                       --------->AHL20(3)
         <---------AHL25(3)             <-----------GT1                       --------->AHL12(1)
         <---------AHL20(2)        <---------AHL20(2)                         <---------AHL12(1)<---
         --------->AHL25(1)        <---------AHL25(1)                        <---------KAN1     ----
         <---------AHL12(3)        --------->AHL12(3)                        <-----------TBP<-------
         --------->AHL12(3)        <---------AHL20(3)                  --------->DOF5.7(1)  <-------
        --------->AHL25(3)         <---------AHL12(3)                 ---------->DOF2 --------->MYB111(2)
      --------->WOX13(2)           --------->AHL20(3)                 --------->DOF5.7(1)  <--------
   ------------>CBF                <---------AHL25(2)             --------------->AGL15    <--------
--CBF <---------WOX13(2)    <-----------GT1 <----------DOF2       <---------------AGL15<-------GAMYB
 
agagttctcaatttatatatacaatttcatttcactatttttttttccttttatatttttagtgaatttcaaaaaaaggaatttattggttgttgcttta  25357800
                                                                                           <--------
                                                                                           <--------
                                                                                      <-------MYC3
                                                   <-----------RAV1(1)            --------->ANAC46
                                          <---------MYB46(3)              <---------AHL20(2)
                                        <-------GAMYB              ------>ZmHOX2a(2)  ------->MYC3
  <---------GLK1(2)                    ------>ZmHOX2a(2)   --------->ALFIN1 <---------ANAC46
------YAB1                             <---------MYB46(3)  <---------ANAC46 <---------ANAC55(2)
------->HVH21         <-----------GT1 <---------YAB5     <---------ANAC46 --------->AHL20(2)<-------
--DAG2      --------->ANAC58          <---------YAB1    <---------ANAC46<---------WOX13(2)<---------ANAC58
---DOF2     --------->ANAC58         <---------ARR11(3)<---------LBD16  --------->WOX13(2)<---------ANAC58
-ANAC58     --------->ANAC46       --------->ICU4 <---------YAB5 --------->ARR11(3)  --------->O2
-ANAC58   <-----------GT1          <---------YAB1<------------CBF<---------ARR11(3)  <---------O2 <-
 
tgacagattagtttcacgctctgtttcacaagatagccatgatcgttgttggaattgttgcggtgtatgatctctaattacttataccacatggcttttt  25357900
               <---------YAB1                              --------->DAG2
             --------->YAB5                          <---------ANAC46
             <---------ICU4                          <---------ANAC58
            <---------YAB1                           <---------ANAC58
 <---------AHL20(3)                                  ----------->GT1          --------->YAB1
<---------AHL12(1)       --------->ANAC46          --------->MYB52(1)         <---------ICU4
<---------AHL25(2)<---------TOE2(3)              <---------MYB59     <---------AtLEC2
--------->AHL12(1)<---------YAB1           <----------DOF2---------->DOF2   <---------YAB1
--DOF2 <---------At4g35610                <---------DOF5.7(1)        <---------ANAC58             <-
-DOF5.7(1)<---------At4g35610      <---------WRKY38(1)--------->TOE1(3)--------->ANAC58           <-
--DOF5.7(1) --------->ICU4        <---------YAB5 <---------MYB46(2)  <---------ANAC58        <------
--------RVE1(2)--------->ICU4 --------->ICU4    ----------------->AGL1 --------->ANAC58     <-------
 
tgatatttttggctgatgattatggtataagtcattagtcaatgctcttttgcctaacgtgaaaagtgttttgcatgctattaatgaccaaaatagtcat  25358000
     <---------AHL25(1)
     --------->AHL25(3)
     --------->AHL20(2)
     --------->AHL25(2)
     <---------AHL25(2)
     --------->AHL25(1)                                             --------->WOX13(2)
     <---------AHL20(2)                                             <---------WOX13(2)
     <---------AHL20(3)                         --------->MYB52(1)<---------AHL20(2)
     --------->AHL20(3)                         -------->P     ----------->GT1
--------ANAC58                       --------->YAB1--------->ANAC46 <---------AHL12(2)     <--------
--------ANAC58                    --------->HSFB2a(2)<---------MYB52(1)                 <---------At5g28300
---ICU4        <-------TEIL------>ZmHOX2a(2)--------->YAB5   ---------->DOF2     <---------KAN1
--YAB5     <---------YAB1<---------RVE1(2) ------->GAMYB --------->RVE1(2)      --------->GLK1(2)
 
ttcttgattttattttgattcatctattgatctgtttctagtataactgactacccgttatatcaaaagttaatttaggggagaatatagttactgcagg  25358100
<- Previous    Next ->

AGI:  At1g67640.1   
Description:  lysine and histidine specific transporter, putative. similar to LHT1 (LYSINE HISTIDINE TRANSPORTER 1), amino acid transmembrane transporter [Arabidopsis thaliana] (TAIR:AT5G40780.2); similar to LHT2 (LYSINE HISTIDINE TRANSPORTER 2), amino acid transmembrane transporter [Arabidopsis thaliana] (TAIR:AT1G24400.1); similar to LHT1 (LYSINE HISTIDINE TRANSPORTER 1), amino acid transmembrane transporter [Arabidopsis thaliana] (TAIR:AT5G40780.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO46653.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO46673.1); similar to histidine amino acid transporter [Oryza sativa (indica cul
Range:  from: 25355791    to: 25357571    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version