AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                              <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)
                                              xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                            ------>MYB46(1)
                                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                          <---------ALFIN1<xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                          --------->AtMYB61
                                          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                          xxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                          <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                         xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                         <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                         --------->MYB46(3)xxxxxxxxxxxxxxxx>smallRNA(i)
                                         <xxxxxxxxxxxxxxxxsmallRNA(si3)
                                         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                         <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                        <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                       <---------PCF5     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                      <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)       xxxxxxxxxxxxxxxxxxxx
                                   <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)           --------->ATHB12
                                   xxxxxxxxxxxxxxxx>smallRNA(i)                <xxxxxxxxxxxxxxxxxsmallRNA(si3)
                                   <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)        ------>ZmHOX2a(2)
                                   <xxxxxxxxxxxxxxxxsmallRNA(i)               xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                   <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)       xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)         --------->GLK1(1)
                               <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)          <---------GLK1(1)
                              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)          <------ZmHOX2a(2)
                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)           --------->ARR14(2)
                            <xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)               <-----------ARR10
                            xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)              <---------ARR14(2)
                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)            --------->RVE1(2)
                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)           <---------GATA12
                            <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)             --------->GATA12
                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)           <---------AGP1  --------
                           <xxxxxxxxxxxxxxxxsmallRNA(i)   xxxxxxxxxxxxxxxx>smallRNA(i)   <---------AtMYB61
                           xxxxxxxxxxxxxxxx>smallRNA(i)   <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                          xxxxxxxxxxxxxxxx>smallRNA(i)    <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)      <
                         xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)                <---------ARR11(2)    <x
                         xxxxxxxxxxxxxxxx>smallRNA(i) ===============================HOX2a_HOX2a <xx
                         <xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)        xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                        xxxxxxxxxxxxxxxx>smallRNA(i)  ------>ZmHOX2a(1)     --------->ARR11(2)   <xx
                        <---------At4g35610 ------>MYB83 <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)   <xxx
                     xxxxxxxxxxxxxxxx>smallRNA(i) xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<xxxxxxxxxxxxxx
                    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3) <-------
                   --------->DAG2 <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                  --------->DOF5.7(1) <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)<xxxxxxxxxxxxxxxxxsmallRNA(fl3)
                  ---------->DOF2 <-----------RAV1(1) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)<xxxxxxxx
           <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)<xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)  xxxxxxxxxxxxxxxx
        --------->ANAC58<---------ZAT2xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3) <---------CCA1(2)<-------
        --------->ANAC58--------->ZAT2<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
        --------->ANAC46--------->At4g35610<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)<---------YAB1<------
     --------->DOF5.7(1)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)      xxxxxxxxxxxxxxxx>smallRNA(i)  <xxx
 <xxxxxxxxxxxxxxxxsmallRNA(i)<xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) <---------ALFIN1 <xxxxxxxxxxxxxxxxx
--->MYB52(1)    <---------AHL25(3)xxxxxxxxxxxxxxxx>smallRNA(i)   <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
-->DOF5.7(1)   --------->AHL20(2) <---------MYB46(3)  ==============================HOX2a_HOX2a <xxx
->DOF2 <---------------------WRI1 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)  <---------LBD16xxxxxxxxxxxxx
 
cggagaagaagacgcaaaataaaaagcagctgtctatttgttggaccaccctatttcctcacatcgttccacttcttcggatctcattggttttggtggt  25353100
                             <---------HSFC1(2)
                             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                             <------MYB83
     ------>MYB83            --------->HSFC1(2)
     ------>MYB46(1)         --------->HSFB2a(1)
   --------->AtMYB61   <xxxxxxxxxxxxxxxxsmallRNA(i)                 <---------MYB46(3)
   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                            <------MYB83
   <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                               <------MYB46(1)
   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                           <xxxxxxxxxxxxxxxxxxsmallRNA(si3)
   --------->MYB46(3) xxxxxxxxxxxxxxxx>smallRNA(i)              <---------MYB46(3)
  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                         <-----------RAV1(1)
  <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                          <xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
  <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
 <xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
 <xxxxxxxxxxxxxxxxsmallRNA(i)<xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)----------------------->TaNAC69(2)
 <xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                          xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)                     --------->YAB1
<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                  --------->ICU4            --------->ANAC58
<xxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
<xxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                    <---------KAN1    <---------bZIP60(1)
--------->REM1(1)    xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)                     <---------YAB5  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
xxx>smallRNA(i2)   ------>MYB83                    xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
->ALFIN1         <---------MYB59                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)              <xxxxxxxxxxxxxxxxsmallRNA(i)      <xxxxxxxxxxxxxxxxxx
xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)          xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   --------->ANAC58
xxxxxxxxxxxxxxxxxxxsmallRNA(si3)           xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)   <xxxxxxxxxxxxxxxxxx
xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)         <---------ANAC58 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)         <---------ANAC58 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
xxxxxxxxxsmallRNA(fl3)---------->DOF2    xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  <xxxxxxxxxxxxxxxxxxxx
--AtMYB61        ------->GAMYB       <------MYB46(1) xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  <xxxxxxxxxx
xxxxxxxxxxxxxxxsmallRNA(i2)  <------MYB46(1)   xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)     ------------
xxxxxxx>smallRNA(i2) <---------KAN1  <------MYB83xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   <-----------
--DEAR3(1)    <-----------GT1<---------HSFB2a(1) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)   ------------
---MYB46(3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)------------>CBF x
xxxxxxxxxxxxxxxxxxxxsmallRNA(i2)<---------MYB46(3)xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<xxxxxxxxxxxxxx
xxxxxsmallRNA(fl3) ------>MYB46(1)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)--------->bZIP60(1)     <--
xxxxxxxxxxxxxxxxxxsmallRNA(i2)<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
xxxxxxxxxx>smallRNA(fl3) xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)xxxxxxxxxxxxxxxxxxx>smallRNA(fl3)xxxxxxx
 
gctacaccaactgtttttaaccgaacaaaggaaggttgtttggtttcttatgttgagaatgatggtgttgttggtgacttcatcactcaattccaattca  25353200
                                                                  <---------WOX13(1)
                                                                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                                                                --------->ATHB12
                                                                <---------ICU4
                                                               --------->ICU4
                                                               <---------YAB5
                                                               <---------YAB1
                                                              <xxxxxxxxxxxxxxxxsmallRNA(i)
                                                     <---------ANAC55(2)
                                                     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                                                     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                  <---------SPL7(1)
                                                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                <---------------AtSPL3
                                           <xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                           <----------DOF2   --------->YAB1
                       <xxxxxxxxxxxxxxxxsmallRNA(i)  --------->ANAC55(2)
             <---------GATA12            xxxxxxxxxxxxxxxx>smallRNA(i)                         <xxxxx
            <---------GLK1(1)        <---------ARR14(2) <---------GLK1(2)     --------->RVE1(2)<xxxx
         <xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)    <---------------AtSPL8        <---------ARR11(3)
         --------->ANAC58            <---------ARR11(2) --------->ARR14(2)   --------->KAN1<--------
         --------->ANAC58            <---------GLK1(2)  <---------ARR14(2)  <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  <xxxxxxxxxxxxxxxxxxxsmallRNA(i2)       <---------WOX13(1)
xxxxxsmallRNA(si3)  --------->ANAC58 --------->ARR14(2) <------------CBF ------------>CBF<---------GATA12
xxsmallRNA(si3)    xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)-------
xxxsmallRNA(i2)    <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3) <-------TEIL
xxxxxxxxxxxxxsmallRNA(fl3)           --------->ARR11(2) --------->ARR11(2)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
----->AGL1  --------->GLK1(1)        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)  <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
------AGL1xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)      <xxxxxxxxxxxxxx
>CBF   xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<xxxxxxxxxxxxxxxxxxsmallRNA(fl3) xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
xxxxxxxxxxxxxxx>smallRNA(i)xxxxxxxxxxxxxxxx>smallRNA(i)<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)xxxxxxxxx
xxxxxxxsmallRNA(si3)--------->ANAC58--------->KAN1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3) --------->KAN1
----ZmHOX2a(1)     <xxxxxxxxxxxxxxxxxxxsmallRNA(si3)<---------LBD16    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
xxxxxxxxxxxxxxxx>smallRNA(i2)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)<------------CBF  ----------->HVH21
 
ggactctccctcaagaaatccacaagctcgacattttccatattcgctttggaagtacggattgtcatgattggaacacaatatccctgatagatgcgga  25353300
                             ---------->DOF2
                          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
    <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
    <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
   <-----------GT1        <---------YAB1
  <-------TEIL           <---------WOX13(2)
 --------->CCA1(2)       xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
 <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
 <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
--------->ARR14(2)      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
<---------ARR11(2)     xxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
--------->ARR11(2)    --------->ARR11(3)                    --------->AHL12(2)
xxxxxxxxxxxxxxxx>smallRNA(i)xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
<---------ARR14(2)    <---------RVE1(2)                     --------->AHL25(1)
xxxxxxxxxxxxxxxxxsmallRNA(fl3)       ------------>CBF       <---------AHL25(2)
xxxxxxxxxxxxxxxxxsmallRNA(fl3)--------->DAG2                <---------AHL20(2)
-LBD16<xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                    <---------AHL12(3)
-->LBD16              xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  --------->AHL12(1)
xxxxxxxsmallRNA(i2)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)  <---------AHL12(1)              ---------
xxxxxxxxxxxxxx>smallRNA(i2)--------->YAB1                <---------RVE1(2)             <-----------HVH21
 
agggatacaccgtttgaatttcatagataatgaaaagtgcttcaataccgaagtaagtttgatttttttttatgttttagtctctatttatgtcacacta  25353400
                                     <---------ANAC58
                                     <---------ANAC58
                          ----------->GT1
                   --------------->AGL15
          <---------ARR14(2)         <---------ANAC46
          --------->ARR11(3)    <---------AHL20(3)
          <-----------ARR10     --------->AHL20(3)
          <---------ARR11(3)    <---------AHL25(2)
          --------->ARR14(2)    <---------AHL12(2)
          --------->RVE1(2)     --------->AHL12(2)                                           <xxxxxx
          --------->ARR14(3)  <---------YAB1                                       <---------ZAT18
          <---------ARR14(3)  --------->AHL25(3)                                   xxxxxxxxxxxxxxxxx
      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)                                   xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
    <---------DOF5.7(2)   <---------ANAC46     --------->YAB5                xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
  --------->DOF5.7(2)   <---------ZAT14       --------->DOF5.7(1)   --------->ZAT6 --------->ZAT18
<---------ANAC46   <----------DOF2  --------------->AtSPL3    --------->GLK1(2) ----------->GT1
>ZAT6------------>CBF   --------->ZAT14     ---------->DOF2------------>CBFxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
 
atgtcgttaacaatatcttcttctttgtgtagtataattttcgtacaaaaagattaagtcaaaacaatctttcactaacaaaatggtgaactatgtgaat  25353500
                 <---------ARR11(3)
           ----------->GT1                    <---------HSFB2a(1)
           <------MYB83                       --------->HSFB2a(1)
           <------MYB46(1)                    <---------KAN1
      --------->ALFIN1                        --------->KAN1
    <---------ANAC46                          --------->KAN4(1)
    <---------bZIP60(2)             ------->MYC2                            --------->ATHB12
    --------->TGA1a                 ------->MYC3                           --------->ICU4
    --------->O2<---------GLK1(1)   <-------MYC3                           <---------YAB5          -
    <---------O2--------->GLK1(1)   <-------MYC2                           <---------YAB1          -
    <---------TGA1a    <---------YAB1         <---------KAN4(1)          --------->YAB1           --
    ====================================bZIP_DOF                      <----------DOF2     <---------AHL20(2)
 ----------->HVH21  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)            <---------DOF5.7(1)--------->AHL12(2)
xxxxxxxxxxxxxxxxsmallRNA(si3)---------->DOF2 <---------RVE1(2)    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
xxx>smallRNA(si3)--------->ARR11(3)<---------KAN1            --------->MYB52(1)   <-----------GT1 --
 
gggctcgacgtggaaggtgatatcttatttttgaaagcatgtggatgggatgttccaagagagattacggtccctttcatgatttatacttattttttga  25353600
          <---------ICU4
     <---------ARR11(2)               <---------MYB52(1)
     --------->ARR11(2)              <---------RAP2.6(3)
   <---------MYB46(3)         --------->CCA1(2)
--------->DOF5.7(1)          <---------RVE1(2)
-------->DAG2  --------->At4g35610   <-------GAMYB  --------->YAB1                      --------->ARR11(3)
-------->DOF5.7(1)         --------->ANAC46         <---------ICU4               <---------AtLEC2
------->DOF5.7(1)     --------->RVE1(2)            <---------YAB5           <---------DOF5.7(1)   <-
-------->DOF2  --------->ANAC46     <---------MYB46(3)                      --------->TOE2(3)     --
 
aaaaagcggttcaacatcacctcactatctacgatatggccgttattgccctgaatcatcgcaaaccccctaaattcaacctttgcaagatggtcttgga  25353700
                                                                                          ----------
                                                                                          <---------
                                                                                     --------->KAN1
                                                                                     <---------MYB46(3)
                                                                                    <--------P
          <---------GLK1(1)                                                        <-------GAMYB
          --------->ARR14(2)                                                    --------->LBD16
          <---------ARR14(2)                                                    <---------LBD16
          --------->GLK1(1)                                                    --------->ANAC46
     ----------->GT1                                          <---------At5g28300 <---------MYB46(3)
     --------->LBD16                                        <-------TEIL<------ZmHOX2a(1) <---------
    <---------ANAC46                --------->ANAC46       --------->CCA1(2)<---------ARR14(2)
   <---------LBD16                <-----------GT1         <---------GLK1(2) --------->ARR11(2)
---------->DOF2             <----------DOF2               <---------GATA12  --------->ARR14(2)
--------ARR11(3)            <---------DAG2                --------->GATA12  <---------ARR11(2)
------->ARR11(3)          ------->TEIL         <---------YAB1 <---------LBD16 <---------LBD16
 
agataatgcggagaattcccaagaagatgaactttttttacgaaagacttatgagaagatagattcacggctagaggagtacccgcggttgttctttaag  25353800
                         --------->MYB111(1)
                         --------->MYB46(2)
                         --------->MYB111(2)
                         ----------->GT1
                      <------MYB46(1)
                      <------MYB83                          --------->bZIP60(1)
                     --------->MYB111(1)                    <---------bZIP60(1)
                     --------->MYB59                      <---------ICU4
                     --------->MYB52(2)                   --------->YAB1
                     <---------AtMYB61                <---------AHL25(3)
                     --------->MYB46(2)               --------->AHL20(2)
                   <---------MYB52(1)                --------->AHL20(2)
                 <------MYB83                        <---------AHL12(3)
                 <---------MYB46(3)                  --------->AHL25(3)
                 <------MYB46(1)                     --------->AHL25(1)
               <---------WOX13(1)                    --------->AHL12(3)
             --------->YAB5                  <---------ANAC46<-----------HVH21
             -------->HAHB4                  <---------REM1(1)
             --------->ATHB12           <--------ATHB1<---------AHL20(2)                        ----
            <---------YAB1              <---------ICU4--------->AHL12(1)                     <------
       --------->At5g28300             <---------ATHB51  <---------ATHB12            ------->TEIL <-
----->AGL15 <---------ATHB12           --------->ICU4<---------AHL25(1)              --------->GATA12
-DOF2 ----------->GT1--------->MYB111(2)--------->YAB1<---------AHL12(1)            <---------CCA1(2)
------AGL15 --------->ICU4     ---------->DOF2  ----------->GT1      <----------DOF2<---------GLK1(2)
 
aagaatagatggtaaatgattggttaggtagttataaagacaataatggtgtagaaataaatcatgtcatgtcttttaggtgttcttgaatctctgtgtc  25353900
                                                        --------->ARR11(2)
                                                      <---------MYB59
                                                     --------->ANAC58
                                                     --------->ANAC55(1)
                                                     ----------->GT1
                                                     <---------ANAC55(2)      <---------AHL25(3)
                                                     --------->ANAC46<---------ANAC58
                                                     --------->ANAC55(2) <---------KAN1
                         ----------------->AGL3 <---------ICU4       <---------ANAC46
                      --------->GATA12          <---------------AtSPL8  <---------ARR11(2)
                      <---------GATA12       --------->ATHB12       <---------LBD16
                     --------->KAN1          --------->YAB5     <---------RVE1(2) --------->DAG2
        --------->WOX13(2)                  --------->ICU4     --------->ATHB12  ---------->DOF2
      ------>ZmHOX2a(1)  ----------------->AGL2 <---------------AtSPL3--------->LBD16
----->WOX13(1)    <---------MYB52(1)      <---------ANAC58    <---------YAB5  --------->AHL20(2)
-----HVH21       --------->TOE2(3)        <---------ANAC58--------->MYB46(3) --------->AHL20(2)
--------YAB5--------->At4g35610     <----------DOF2  --------->ANAC58<---------ANAC58       <-------
 
agtcatttcctaatgagcacccttagattccaaatacagcttttggcctgattagtacgtaactactgatttgcggataaataaaaaagtattagtaact  25354000
<- Previous    Next ->

AGI:  At1g67635.1   
Description:  similar to phosphatidylinositol 3- and 4-kinase family protein [Arabidopsis thaliana] (TAIR:AT1G27570.1); contains domain PTHR15245:SF11 (PTHR15245:SF11); contains domain PTHR15245 (PTHR15245)
Range:  from: 25353483    to: 25353815    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version