AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                          --------->GLK1(2)
                                          <---------ARR14(2)
                                          --------->RVE1(2)
                                          <---------ARR11(2)
                                          --------->ARR11(2)
                                <------ZmHOX2a(1)                                        --------->WOX13(1)
                              <---------TOE1(2)     --------->KAN1                     <------ZmHOX2a(2)
                              --------->LBD16  <---------MYB52(1)                     <---------ARR11(2)
   <---------ANAC58          <---------LBD16 <-----------RAV1(1)                      <---------GATA12
   <---------ANAC58          <-----------RAV1(2)   <---------RVE1(2)                  --------->GATA12
-------->LBD16               ============================RAV                   <----------DOF2
----->ZmHOX2a(1)        --------->KAN1    --------->ARR14(2)                --------->ANAC46  ------
-CCA1(2)               <-------TEIL      <---------KAN1            ----------->RAV1(1)--------->ARR11(2)
 
tcctggtcttgccatcgaaacctagtttcatcccaggaagaagagtatctgttggataatcgaaactttgccacaaaacccgcttcatcgatccatcagc  25309100
                          --------->ARR14(2)
                          --------->RVE1(2)
                       --------->LBD16
                      --------->HSFC1(1)
                      <---------HSFB2a(2)
                      --------->HSFB2a(2)
                  --------->GLK1(1)
                 --------->ARR14(2)
                 --------->GATA12
                 <---------GATA12
                 --------->ARR11(3)                                                   <---------MYB46(3)
                 <---------ARR14(2)                                                  <--------P
          --------->At4g35610     --------->At4g35610                              --------->ATHB12
          --------->ZAT2  --------->GLK1(2)                                     --------->YAB1
          <---------At4g35610  ---------->DOF2                                --------->ANAC58
          <---------ZAT2 <---------GLK1(2)         <---------ANAC46           --------->ANAC58
 <---------CCA1(2)<---------GLK1(1)                <---------ANAC58      <---------At4g35610
--->At4g35610    <---------ARR11(3)                <---------ANAC58      --------->At4g35610   -----
 
atccatctcttggagctgaagatttccagaatccaaaagctgaagggttgtgtttcttgtggtttctatagagcttagctcaagcatggttgatgctcct  25309200
                      <---------ARR11(2)                                 --------->WOX13(1)
                      --------->GLK1(2)                             <---------MYB52(1)
                      --------->GATA12                             <-------GAMYB
                      <---------GATA12                           <---------TOE1(3)
         --------->GATA12              --------->HSFB2a(2)       <---------TOE2(3)
         <---------GATA12     --------->ALFIN1                   <---------ANAC46
  --------->ARR11(3)  <---------ARR14(2)                        <---------At5g28300
  <---------ARR11(3)  --------->RVE1(2)<---------HSFB2a(2)     <-----------GT1                     -
  --------->GATA12    --------->ARR14(2)                    <---------MYB46(3)                     -
->ZmHOX2a(1)          --------->ARR11(2)   --------->ZAT14<---------RVE1(2)                 ------>ZmHOX2a(1)
 
cttaaaatcttcaatctgccaagagaatccactgtgaggcttccagagcggtctgagattggattgttacggttagcaatccagacaggtctgtcctggc  25309300
                 <---------MYB46(3)
               <---------GLK1(2)                                                               <----
             --------->DOF5.7(1)      <-------TEIL                                             -----
             --------->ICU4          --------->CCA1(2)                                         <----
           ---------->DOF2          <---------ARR11(3)                                         -----
       <---------TOE2(3)          --------->ANAC46            ----------->GT1           ---------->DOF2
       <---------YAB1    <---------MYB59                 ---------->DOF2          <---------GATA12
-------->YAB1<---------YAB5------>MYB46(1)            --------->TOE2(3)           <---------ARR11(3)
-------->ZAT6<---------YAB1------>MYB83            --------->GLK1(1)              --------->ARR11(3)
 
tatcagtattaagataaagattgttgaaccaaattccaagatacaagttttctgaattcttaaagttgaaaaacttgagtttgaagattttaaaagcaga  25309400
                                                 <-----------GT1
                                         --------->GLK1(2)
                                         <---------ARR11(2)
                                         --------->RVE1(2)
                                         ------->TEIL
                                         <---------ARR11(1)
                                         --------->ARR11(2)
                                         <---------ARR14(2)
                                        <---------CCA1(2)
                                        <---------KAN1
  <---------ARR11(3)                  <---------ANAC58           ------>ZmHOX2a(1)
  --------->ARR11(3)                  <---------ANAC58          <---------MYB59
-----ARR14(2)           ----------->HVH21--------->ARR14(2)  <-----------GT1               <--------
---->ARR14(2)        <---------ARR11(3) <---------ARR14(1)<---------ARR11(3)    ----------->GT1   --
-----ARR11(2) <----------DOF2         <---------ANAC46<---------AtLEC2         --------->DAG2    ---
---->ARR11(2)<---------DOF5.7(1) <---------REM1(1) --------->ANAC46           ---------->DOF2  -----
 
aacgagctcttgcccatctttcaagaactgaccctgatgtagcgtatctgtttcactgcatgattttcctaacaagagagataaagtaagaagagagaca  25309500
                                                                               <---------ARR11(3)
                                                                               --------->ARR11(3)
                                                                            --------->CCA1(2)
                                                                           --------->ARR11(3)
                                  --------->ATHB12                      <---------TOE2(3)
--ID1                     --------->DOF5.7(1)                  ----------->GT1<---------CCA1(2)
------->KAN1            ---------->DOF2                   ---------->DOF2  <---------ARR11(3)
------>DOF5.7(1)     --------->HSFB2a(2)             <----------DOF2   ---------->DOF2
----->DOF2           <---------HSFB2a(2)         <---------GLK1(1)  <-----------TBP           ------
 
aagatgccatttgaacacatagtttcagaaagatggatgatttggcaaatagatttctttctaaagtggttttttaaagatatatcttgtttgtgatcaa  25309600
                                                                                 --------->YAB1
                                                                         <---------At4g35610
                                                                     --------->MYB52(1)
                                                                     ----------->RAV1(1)          --
                                                                  --------->ANAC58              ----
                               <----------ARF1       --------->At4g35610 --------->At4g35610    ----
                       --------->ZAT14               <-------GAMYB--------->ANAC58       <---------WOX13(2)
  --------->RVE1(2)    <---------ZAT14              <---------MYB46(3) --------->MYB46(3)--------->WOX13(2)
---->DOF2         --------->ZAT18     <------------CBF            --------->ANAC46     --------->AHL20(2)
 
agtcatatcagaagttccaagtctactacgctgggagacaaaattgaagtcttggccgttgaagtttctaagcaacagctgttatcacaactaattagca  25309700
                                                                 --------->ANAC58
                                 --------->TOE1(3)               --------->RAP2.6(2)
                                 --------->TOE2(3)--------->ANAC46------>NtERF2
                                <---------ANAC55(2)  --------->MYB52(1)
                          <---------YAB1 --------->ANAC58        --------->ANAC46
                         <---------DOF5.7(1)      --------->ANAC55(2)
                    --------->WRKY12     --------->ANAC58 --------->ARR11(2)                       <
-------->DOF2       --------->WRKY38(1)  --------->ANAC46 <---------ARR11(2)   ------------>CBF    -
----->ANAC58    <---------TOE2(3)<---------MYB59  --------->YAB1 --------->ANAC58                <--
----->ANAC58<------------CBF  <-----------GT1    <-------TEIL   --------->SPL7(1) <------------CBF<-
 
agaaagtgaccacaaaattgaagttgactcttattacctaaaacaagacacatacataacagaaccagacgccatgctcttgagcaattgtttttgtttt  25309800
          ================================================bZIP_DOF
          --------->ANAC58
          =============MYC_MYB
          --------->TGA1a
          =============MYC_MYB
          --------->ANAC58
          <---------TGA1a
          --------->ANAC46
       ----------->HVH21
     --------->At4g35610
    --------->ARR11(3)                            --------->DOF5.7(1)
    <---------ARR11(3)                   <------ZmHOX2a(1)
    --------->RVE1(2)                  <---------TOE2(3)
   <---------KAN1                     --------->YAB1                           --------->ANAC58
  ------->TEIL                       <---------ATHB12                          --------->ANAC58
------->GAMYB <-----------RAV1(1)--------->MYB46(3)               --------->TOE2(2)
====================MYC_MYB     --------->ANAC46 --------->DAG2   --------->TOE1(2)
---------MYB52(2)               --------->ANAC58 --------->DOF5.7(1)         --------->DOF5.7(1)
-------->MYB46(3)              ------->GAMYB <---------AHL20(2)  ----------->RAV1(2)
---------GT1  <---------MYB46(3)--------->ANAC58--------->DOF5.7(1)          ---------->DOF2
--------TOE2(3)<-------GAMYB  <---------ALFIN1 ---------->DOF2  -------->P <---------AHL25(3)      -
 
taacgaacatctcacgcctgttgggagaatacaacacccaataaggatttaaaagggggagactacttacctgagaaataaaaagccaattgctaccaag  25309900
                                                                                                   -
                                                                                                  <-
                                                                                                 ---
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                              <-----
                                                                                              ------
                                                                                             <------
                                                                                             -------
                                                                                            --------
                                                                                            <-------
                                                                                           ---------
                                                                                           <--------
                                                                                    ----------->GT1<
                                                                                  ---------->DOF2<--
                                                                          <---------YAB1   ---------
                                                     <---------YAB5      --------->TOE2(3) <--------
                                                     <---------YAB1    <---------ARR11(1)  <--------
                                                   <---------ICU4      --------->ARR14(2)  ---------
                                        --------->DAG2                 <---------ARR11(3)  ---------
                                       ---------->DOF2   <-------TEIL  <-----------ARR10   <--------
                                       --------->DOF5.7(1)             <---------GATA12    ---------
         ----------->GT1        <----------ID1    <---------YAB1       --------->GATA12   <---------AHL12(2)
<------ZmHOX2a(1)               --------->DOF5.7(1)--------->YAB1      --------->RVE1(2)  --------->AHL12(2)
---------->GT1                ---------->DOF2     <---------YAB5      <---------CCA1(2)>>>>>>>>>>GT-3b
 
agaggagaaacagagttatatcatttcttcataaaaagacaaaaaagtatttcatcatggttcataaaaccccaaatcttattggtaaagaaaaataaat  25310000
<- Previous    Next ->

AGI:  At1g67520.1   
Description:  lectin protein kinase family protein. similar to CES101 (CALLUS EXPRESSION OF RBCS 101), carbohydrate binding / kinase [Arabidopsis thaliana] (TAIR:AT3G16030.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45907.1); contains InterPro domain Apple-like (InterPro:IPR003609); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threonine protein kinase, active site; (InterPro:IPR008271); contains InterPro domain Tyrosine protein kinase; (I
Range:  from: 25306389    to: 25309520    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version