AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
        --------->ALFIN1
      <----------DOF2                                                 <---------ARR11(3)
      <-------GAMYB                                                   --------->AHL20(1)
     <---------DEAR3(1)                     --------->DAG2            --------->ARR11(3)
  <---------DEAR3(1)                       ---------->DOF2            <---------RVE1(2)
--------->GATA12                           --------->DOF5.7(1)  >>>>>>>>>RAP2.2
<---------GATA12                         <---------AHL25(3)   --------->RVE1(2)
-------->TGA1a                          --------->AHL20(2)    <---------ARR11(3)
-------->O2                       <---------AHL20(2)          --------->ARR11(3)
---------O2                       --------->AHL20(2)         --------->GLK1(1)
-------->RAV1(1)                 <---------AHL20(2)          <---------GLK1(1)
-------ALFIN1                    --------->AHL20(2)         --------->ARR11(3)
->GAMYB--------->ALFIN1         <---------WOX13(2)          <---------ARR11(3)
-->MYB46(3)                    <---------WOX13(2)           <---------RVE1(2)
->At4g35610        --------->REM1(1)  --------->YAB1       <<<<<<<<<RAP2.2     ----------->GT1
>MYB52(1)    --------->ZAT18   --------->WOX13(2)     ------->TEIL---------->DOF2                 --
 
ccacatcggcgttgtggccactacatctctctgtaatttaaaaataaaaagtgaatgaatttagatatctaaagatattgtatagaaaatatagattata  24713000
                                       --------->ARR14(2)  <---------WOX13(2)
                                       --------->GATA12    --------->WOX13(2)
                        --------->KAN1 <---------ARR11(2) --------->ATHB12
                        --------->GLK1(1)                 <---------ICU4
                        <---------GLK1(1)              --------->WOX13(2)
                        --------->CCA1(2)   --------->ANAC46
                        --------->RVE1(1)   --------->ANAC58
                       <---------ARR11(3)   --------->ANAC58                         ----------->GT1
        --------->GLK1(1)              --------->ARR11(2)<---------AHL20(2)        --------->MYB52(1)
        <---------GLK1(1)       ---------->DOF2        <---------WOX13(2)       --------->bZIP60(1)
  <---------ZAT2       --------->ARR11(3)<-------TEIL<-------TEIL               <---------bZIP60(1)
  --------->At4g35610  --------->ARR14(2)<---------WRKY38(1)    ------->TEIL    --------->TGA2(1)
  ----------->RAV1(2)  <---------ARR14(2)<---------WRKY12--------->AHL20(2)------>MYB46(1)      ----
  --------->ZAT2 <---------HSFB2a(2)   <---------ARR14(2)<---------AHL25(1)------>MYB83      -------
------->ANAC46   --------->HSFB2a(2)   <---------GATA12--------->TOE2(3) <---------MYB59     <------
 
cactcacctggatttctcttacagaagatatcccatagagcaggtccacgacaagtttcattaattgcaccttcaacctaatgacataacgaaaatagct  24713100
                                                                            <---------ANAC55(2)  ---
      ----------->GT1                                                       --------->ANAC55(2)<----
     <---------TOE1(3)                                             --------->ZAT14             -----
     <---------TOE2(3)                                             <---------ZAT14             -----
----->At4g35610                                       <---------YAB1--------->ZAT6             <----
-->At4g35610                                 <---------ANAC58     ----------->RAV1(1)     --------->ZAT14
---At4g35610      <---------YAB1             <---------ANAC58    --------->ANAC46         <---------ZAT14
 
gatgagttgaggtaataacatatgtttgaattcagcatttggacttaggcttgaattttgatggagacacaacactaatacatatttttgaagtatagtg  24713200
       <---------AHL20(2)
    --------->YAB5
    --------->AHL12(1)
    <---------AHL25(3)
    <---------AHL12(1)
   <---------AHL12(1)
   --------->AHL25(1)                          --------->At4g35610
   --------->AHL12(3)                          --------->ZAT2
   --------->AHL20(2)                    <---------At4g35610                     <---------ANAC58
   --------->AHL25(3)                    <---------ZAT2                          <---------ANAC58
   <---------AHL25(1)                    --------->At4g35610                --------->HSFC1(2)
   <---------AHL20(2)                    --------->ZAT2                     <---------HSFC1(2)
   <---------ATHB51                     ----------->RAV1(1)      --------------->AGL15
   --------->AHL12(1)                --------->ANAC46            <---------------AGL15
  --------->AHL12(2)                 --------->ANAC58           ----------------->AG
-------->GT1                   --------->TOE2(3)                <-----------------AG
-----ZAT14                     --------->TOE1(3)                ----------------->AGL1
---->ZAT18                    ======================RAV         <-----------------AGL1
---->ZAT14                    ----------->RAV1(2)               ----------------->AGL2
-----ZAT18          ----------->HVH21--------->ANAC58          <-----------------AG ----------------
 
tagtaaataattcattttgatgtctcacagtttacctgaaacgcagcagtagctgtgccaaacacaaacccattagggaaacttgctcggcttagtttgg  24713300
                <------ZmHOX2a(2)
               --------->ARR14(2)
               --------->ARR11(3)
               <---------ARR11(3)
         <---------ALFIN1                            <---------YAB1     <------ZmHOX2a(1)
      <---------ZAT18                           --------->YAB1        --------->LBD16
      --------->ZAT18                           --------->YAB5       <-----------RAV1(2)
  <---------MYB52(1)    ------>NtERF2    --------->ANAC58          ----------->RAV1(1)
 <-------GAMYB<------ZmHOX2a(1)        --------->CCA1(2)     --------->DOF5.7(1)
------->TaNAC69(2)     <---------DEAR3(1)--------->ANAC58  ---------->DOF2        <----------DOF2
 
acgtcgttgggcacacaggatcatcgacggctattgtcgaagagacgacaatggttatgagaaaaagaagccccaggagagggaacttttgcaatgccat  24713400
                                                                                     <------------CBF
                                                                             <---------YAB5
                                                                           ----------->GT1
                                                                       <---------AHL25(3)
                                                                      --------->YAB1 >>>>>>>>>ARR2
                                                                      <---------AHL12(1)
                                                                      --------->AHL20(3)
                                                                      <---------AHL12(3)
                                                                      <---------AHL20(2)
                                                                      --------->AHL20(2)
                                                                      --------->AHL12(3)
                                                                      <---------AHL25(1)    <------MYB46(1)
                                                                      <---------AHL20(3)    <------MYB83
                                                                      --------->AHL12(1)   ---------
                                                  --------->GATA12    --------->AHL25(1)   ---------
                                                  <---------GATA12   <---------YAB5  <---------RVE1(2)
                        <----------ID1         *TSS                 <---------WOX13(2)  --------->ATHB12
                 <---------HSFB2a(2)   --------->ATHB12             --------->WOX13(2)<---------WOX13(1)
                 --------->HSFB2a(2)  <---------YAB1          <---------ARR11(3)    --------->ATHB12
              <----------DOF2         <---------YAB5          --------->ARR11(3)   <---------YAB1 --
             <---------DOF5.7(1)      --------->ICU4         --------->GLK1(1) <---------RVE1(2)  --
 
ggtttctaatttttggtcttttggaagagaacaagtttgtgatgatttgtttacatctaaacagagttcttaattatatagtgattttgattgtttggta  24713500
                                           <-----------TBP
                                        <---------AHL20(2)
                                    <---------AHL12(1)
                                    <---------AHL20(2)
                                    --------->AHL25(1)
                                    <---------AHL25(3)
                                    <---------AHL25(1)
                                    <---------AHL12(3)
                                    --------->AHL12(3)
                                    --------->AHL20(2)
                                    --------->AHL12(1)
                                   <---------AHL12(1)
                                   --------->AHL20(1)
                                   --------->AHL12(1)
                                   --------->AHL12(3)
                                   <---------AHL25(1)
                                   --------->AHL25(2)
                                   <---------AHL25(2)
                                   --------->AHL20(2)
                                   <---------AHL20(1)
                                   <---------AHL25(3)
                                   --------->AHL25(3)
                                   --------->AHL25(1)
                                   <---------AHL20(2)
                                   <---------AHL12(3)
                                  <---------AHL25(2)
                                  --------->AHL12(3)
                                  <---------AHL12(3)
                                  --------->AHL12(2)
                                 --------->AHL12(2)
                                --------->AHL25(2)
                                <---------AHL12(2)                                                --
                                <---------AHL12(3)                                               ---
                                --------->AHL12(3)                                               ---
                               <---------AHL20(3)                                                <--
                               --------->AHL20(1)                                               <---
                               --------->AHL20(3)                                             <-----
                               --------->AHL12(3)                                             ------
                               <---------AHL20(2)                                             <-----
                               <---------AHL20(1)                                             <-----
                               --------->AHL20(2)                                             <-----
                               --------->AHL25(1)                                           <-------
                               <---------AHL25(1)                                        <---------AHL12(2)
                               --------->AHL12(1)                                       <---------AHL25(3)
                               <---------AHL12(1)                                       --------->AHL20(3)
                               <---------AHL25(3)                                       <---------AHL25(1)
                               <---------AHL25(2)                                       <---------AHL20(3)
                               --------->AHL25(3)                                       --------->AHL25(1)
                               --------->AHL25(2)                                       --------->AHL25(2)
    <---------KAN1            --------->AHL25(3)                                        --------->AHL20(2)
>MYB46(2)          <---------YAB1<---------AHL12(2)                                     <---------AHL25(2)
>MYB59--------->ANAC46     <---------AHL20(2)                                           <---------AHL20(1)
------->YAB1 --------->ZAT14 <---------WOX13(2)                                         <---------AHL20(2)
------->YAB5 <---------ZAT14 --------->WOX13(2)              --------->ANAC55(2)        --------->AHL20(1)
 
atgacaaataagtcactaaactatatttgtttaataaatttattttatatataggtgtgttcttacttatttttcaaagtttggaacatattatattacg  24713600
                                           --------->RVE1(2)
                            --------->AHL12(3)
                            <---------AHL12(1)
                            <---------AHL20(2)
                            --------->AHL25(3)
                            --------->AHL25(1)
                            <---------AHL20(3)
                            --------->AHL20(2)
                            <---------AHL12(3)
        --------->YAB1      --------->AHL20(3)
      --------->AHL20(2)    <---------AHL25(1)
   <---------KAN1           --------->AHL12(1)
------->ALFIN1          --------->AHL20(2)------>ZmHOX2a(1)
------>LBD16          <----------DOF2 --------->ARR14(2)
---->MYC3          ------->TEIL       ------->TEIL                       ------>ZmHOX2a(1)
-----MYC3        ------->MYC2         --------->ARR11(2)  --------->AHL12(1)
------ANAC46     <-------MYC2         <---------ARR14(2)  --------->DOF5.7(1)
----ANAC58       <-------MYC3<---------AHL20(2)          --------->AHL20(2)
--->ANAC55(2)    ------->MYC3<---------AHL25(3)          <---------AHL25(1)
----ANAC58      <---------ANAC58      <---------ARR11(2) --------->AHL12(3)
----ANAC55(2)   <---------ANAC58     <---------CCA1(2)   --------->AHL25(2)
----ANAC46 --------->YAB1 <---------WOX13(2)             <---------AHL12(2)
----GT1<---------AHL20(2) --------->WOX13(2) --------->YAB1        ------->TEIL --------->ZAT14<----
 
cgtggaacatataataaaaacgtgcctttaaataaatagtgtatcctatcaaaaaaaaaaaaaaatcgtgtatgtcctataactgaagtcttcatctatt  24713700
                  <---------AHL12(1)
                  <---------AHL25(2)
                  --------->AHL12(1)
                 <---------AHL12(2)
                --------->AHL12(3)                                        <---------GLK1(1)
                <---------AHL12(3)                                        <------ZmHOX2a(2)
                --------->AHL25(2)                                        <---------KAN1
                --------->AHL20(3)                                        --------->GLK1(1)
                <---------AHL25(2)                                       <---------ARR11(3)
                --------->AHL25(3)                                       --------->ARR14(2)
                --------->AHL12(2)                                       <---------ARR11(2)
                <---------AHL12(2)                                       <---------ARR14(2)
                <---------AHL20(3)                                       <---------GATA12
               <---------AHL25(3)                                   --------->MYB52(1)
               <---------AHL25(1)                            --------->TOE2(3)
               <---------AHL25(2)                     <-----------GT1    --------->ARR11(2)
               --------->YAB1                   <---------TOE2(3) <---------YAB5
               <---------AHL20(3)           --------->YAB1   --------->HSFB2a(2)   <---------AHL20(2)
               --------->AHL20(3)     ----------->RAV1(1)    --------->YAB1------>ZmHOX2a(2)
               --------->AHL20(2)  --------->ANAC58  --------->AHL25(1)  <---------AGP1            -
         <---------DOF5.7(1)   <-----------GT1 <-----------GT1  --------->YAB1    --------->AHL20(2)
        ---------->ID1  <---------ANAC46 --------->YAB1 <---------YAB5   --------->ARR11(3)        <
 ------->TEIL  --------->AHL12(3)  --------->ANAC58  <---------AHL20(2)  ------->TEIL  --------->YAB5
-------RAV1(1) <---------AHL12(3)  --------->ANAC46 --------->AHL20(2)   --------->GATA12    <------
 
gttgcaccttcgtcttaataatatttctcgtgtttaacgagcaacaatattaacatttaatcttccataatcaacggatctctcatttaatgtctacttt  24713800
             ------>ZmHOX2a(2)
            <------ZmHOX2a(2)
           --------->AGP1            <---------GLK1(1)
           <---------ARR14(2)        --------->CCA1(2)
           <---------ARR11(3)        --------->KAN1                    --------->AHL12(2)    -------
           <---------ARR11(2)       <---------RVE1(2)                  <---------AHL12(2)    <------
           --------->ARR14(2)       --------->ARR11(1)                 <---------WOX13(2)    -------
           --------->ARR11(2)       --------->ARR11(3)               <---------AHL20(2)      <------
           <---------AGP1 ---------->DOF2                          --------->TOE2(3)         -------
           <---------GATA12         <---------ARR11(3)      <--------HAHB4                   -------
           --------->ARR11(3)       --------->ARR11(2)      <---------ICU4                   <------
           --------->RVE1(2)        <---------ARR14(2)      --------->YAB1            -------->HAHB4
           --------->GATA12         --------->ARR14(2)     <---------ATHB12          --------->ICU4
      -------->P       --------->ANAC46                    <---------YAB5            <---------YAB5
--------->KAN1         --------->ANAC58                <---------MYB52(1)       --------->YAB1<-----
-------->ARR14(2)      --------->ANAC58               --------->TOE2(3)--------->WOX13(2)------>ZmHOX2a(2)
---------ARR14(2)  <-----------GT1----------->ARR10  ----------->GT1 --------->AHL20(2)--------->ARR11(3)
----DOF2  <---------CCA1(2)     ---------->DOF2     <------NtERF2  <----------DOF2 --------->YAB1  <
 
caaatatgcaaccagatctgttttacaagaaaagaaaaagatatgccaacaaggcctcgttaatcattttctttaattttctatagtaatgatccagatc  24713900
<- Previous    Next ->

AGI:  At1g66280.1   
Description:  glycosyl hydrolase family 1 protein. similar to beta-glucosidase (PSR3.2) [Arabidopsis thaliana] (TAIR:AT1G66270.1); similar to beta-glucosidase (PSR3.2) [Arabidopsis thaliana] (TAIR:AT1G66270.2); similar to PYK10 (phosphate starvation-response 3.1), hydrolase, hydrolyzing O-glycosyl compounds [Arabidopsis thaliana] (TAIR:AT3G09260.1); similar to beta-glucosidase [Brassica nigra] (GB:AAB38784.1); similar to beta-glucosidase [Brassica napus] (GB:CAA57913.1); contains InterPro domain Glycoside hydrolase, catalytic core; (InterPro:IPR013781); contains InterPro domain Glycoside hydrolase, family 1; (InterPro:IPR001360)
Range:  from: 24710175    to: 24713448    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version