AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        --------->DOF5.7(1)
             --------->YAB1                                                           ---------->DOF2
        <---------ATHB12                               --------->DOF5.7(1)     --------->AtLEC2
   --------->YAB1                                     ---------->DOF2          --------->ANAC58    -
---->ZmHOX2a(1)    --------->YAB5                     --------->DOF5.7(1)      --------->ANAC58    -
------>TOE2(3)     ----------->GT1      ------>ZmHOX2a(1) <------ZmHOX2a(1) <---------YAB1   -------
-->GLK1(1)  <---------ATHB12--------->TOE1(3)     --------->AHL20(2)        <---------YAB5 ---------
---GLK1(1)--------->WOX13(1)--------->TOE2(3)     --------->YAB1          --------->YAB1---------->DOF2
 
cctcaatcgaaatcaatcaaaatggttaaaaccttaagaagtccttgtttcaataaaaaaaggattcaacttgaacatcatcatgcaaacaaagagcaga  24601800
                                                                  --------->TOE2(3)             <---
                                                                 --------->YAB5          ------>MYB46(1)
                                                                 <--------HAHB4          -----------
                                                                 -------->ATHB1          ------>MYB83
                                  --------->ANAC46               --------->ATHB12      --------->MYB46(3)
    --------->MYB52(1)         --------->ZAT14                  <---------ATHB12      --------->ANAC58
--------->DAG2                 <---------REM1(2)       --------->DAG2                 --------->ANAC58
-------->DOF5.7(1)             <---------ZAT14        ---------->DOF2       --------->KAN1  --------
--------->DOF2               --------->ANAC46      --------->YAB1<---------ICU4  <---------HSFB2a(2)
---->GT1                   --------->ZAT6          --------->YAB5--------->YAB1  --------->HSFB2a(2)
>At4g35610                 --------->ANAC46       <---------YAB1<---------YAB5   <---------HSFC1(1)
 
gaaaaagtaacgaattggtcatagtaatctacactacacacagagaagttttgatgataaagtttgaatcattaaccatgaattcgagaacccaacatta  24601900
                                                                           --------->HSFB2a(2)
                                                                           <---------HSFC1(1)
                                                                           <---------HSFB2a(2)
                                                                          ------>ZmHOX2a(2)
                                                                         <------ZmHOX2a(2)
                                                                         --------->CCA1(2)
                                                                        --------->ARR11(3)
                      <---------WOX13(2)                                --------->ARR14(2)
                     --------->ATHB51                                   <---------ARR11(3)
                     <---------ICU4                     <---------YAB5  <---------GATA12
                    <---------YAB1                      <---------KAN1  <---------AGP1
                    --------->ICU4                     --------->RVE1(2)<---------ARR14(2)
                  --------->YAB5                       --------->GLK1(2)--------->AGP1
                  --------->YAB1               --------->MYB52(1)       --------->RVE1(2)
                --------->RVE1(2)              ------>MYB46(1)          --------->GATA12
            --------->YAB1                     ------>MYB83       --------->AHL12(2)
     --------->RVE1(2)--------->WOX13(2)       -------->P --------->WOX13(1)                   -----
------TOE2(3)   <---------ARR11(3)             ----------->RAV1(1)--------->WOX13(2)     --------->WOX13(2)
>RAV1(1)   <---------ATHB12                   --------->ANAC46    <---------WOX13(2)     <---------WOX13(2)
->TOE2(3) --------->RVE1(2)                  --------->MYB46(3)   <---------AHL12(2) <---------KAN1
 
agaaatcaaatcaaatcaaaatcataatttggagcaattctatagaaacccaccagagaatcaatcgaaaattaagatctagaagcgaatttaactgaga  24602000
                                                   <---------DOF5.7(1)
                                                   --------->KAN1                                <--
                                             --------->DOF5.7(1)                           ---------
                                       --------->RVE1(2)                                   <--------
                                       <---------GATA12                     --------->ANAC58    <---
           <---------RVE1(2)           --------->GATA12       <------ZmHOX2a(1)            <--------
       <----------DOF2 --------->MYB52(1)   ---------->DOF2--------->At4g35610   <---------WOX13(2)
----->DOF2--------->YAB1     <------ZmHOX2a(1)--------->DOF5.7(1)           --------->ANAC58   <----
 
aaggaaaaccctttgataagaaaacataccgaggaaagtctgaatccaaaagggtttttcgcagaggaagagaaatcgcaagaaaattgaagcgttttcg  24602100
                                                                                                  <-
                                                                                                 <--
                                                                                                 <--
                                                                                                <---
       <---------GATA12      <---------ANAC58                 <---------ANAC58            <---------AHL20(2)
      <---------GLK1(1)      <---------ANAC58                 <---------ANAC58         --------->ARR11(3)
-------TOE1(2)       <---------MYB46(3)          --------->CCA1(2)     <----------DOF2 <---------ARR11(3)
>ARR11(2)           <---------AtMYB61           <---------GATA12   <-----------GT1     --------->GATA12
-ARR11(2)        <---------AtMYB61          --------->DOF5.7(1)    <---------ARR11(2)  <---------RVE1(2)
------MYB52(1)   --------->ALFIN1    ----------->GT1          <---------ANAC46     <---------MYB52(1)
-ARR14(2)     --------->GATA12      ----------->GT1         <---------ANAC46      --------->TOE2(3)<
---GAMYB     <XXXXXXXXXXXXXXXXXXXXMIR161.1---------->DOF2<----------DOF2        *TSS   <---------GATA12
 
ttggattagaaatctccgatgtggtggtttttgcttcagaggttaaaaagagatttagggcttttgtgtgtttccttttgtttttcgttagattttatgc  24602200
                                                                             <---------MYB52(1)
                          ----------->RAV1(1)                               <-------GAMYB
                        <------NtERF2                                 --------->WOX13(2)
           --------->ARR11(2)                                      ------------>CBF
           <---------ARR11(2)                                      <<<<<<<<<<WRKY43             ----
         <---------DOF5.7(1)      <---------SPL7(1)                <<<<<<<<<<WRKY38           ------
    ---------->DOF2   --------->TCP16(1) <------ZmHOX2a(2)         <<<<<<<<<<WRKY26           <-----
--------DOF5.7(1)     <---------PCF2 --------->MYB46(3)          <------MYB83--------->ARR11(2) ----
--------DOF2          --------->PCF5 --------->DEAR3(2)          <------MYB46(1)     --------->ARR11(2)
-------DOF5.7(1)    <---------ATERF1(1) --------->RVE1(2)        ----------->GT1     <---------RVE1(2)
------DOF5.7(1)    --------->ALFIN1--------->ARR11(2)           --------->MYB59      <---------ARR11(2)
-----------TBP   --------->DEAR3(1)<---------ARR11(2)  ---------->DOF2<---------WOX13(2)     <------
 
ctttttataaagcctttccaccgtggccccaacatgtcgaaccgatcaaagtatagaccaaagttgtttggtcaatttcggttagactgatacggtcgaa  24602300
                                                                      --------->AHL25(2)
                                                                      --------->AHL25(1)
                                                               <-----------GT1
                    ------->TEIL                              <---------AHL20(2)
                    <-----------GT1                       <---------MYB52(1)
         --------->PCF5                                 <---------ANAC58
         --------->TCP16(1)                             <---------ANAC58
         <---------PCF2                                 <---------ANAC46
       <---------ATERF1(1)                           <-----------GT1  <---------AHL20(2)
      --------->ALFIN1 <---------DAG2          <---------AHL20(3)     <---------AHL25(2)
  <---------At5g28300  <----------DOF2         --------->AHL20(2)     --------->AHL12(3)     -------
<------ZmHOX2a(2)----------->GT1               --------->AHL25(1) <---------ICU4             -------
----->MYB46(3)   <---------ANAC55(2)           <---------AHL20(2) <--------HAHB4             <------
--->ARR11(2)     --------->ANAC55(2)           --------->AHL20(3) --------->YAB1            <-------
----ARR11(2) ----------->RAV1(1)              <---------DOF5.7(1)<---------YAB5             --------
----->DEAR3(2)   --------->ANAC55(1)--------->ZAT6 --------->KAN1<---------ATHB12           <-------
---SPL7(1) <------NtERF2          <-----------GT1 <---------AHL20(2) <---------DOF5.7(1)    <-------
 
ccgatcaccgtggccccaacatgtaactttttccatcttacactctccatttttttattccgtttttaatcatttttttttggagtttttgcacaatgat  24602400
                                                               --------->ZAT18
                                                           <-------MYC3
                                                           ------->MYC3
                                                          --------->TGA1a
                                                          <---------TGA1a
    <---------At4g35610                                 --------->TGA1a
    --------->At4g35610                          <---------ARR14(2)
-->ATHB12                                        --------->ARR14(2)<---------ATHB12
-->YAB5                 <---------DAG2          --------->KAN1 <---------ZAT18
--ATHB1                 ==========================================bZIP_DOF
--ATHB12                <----------DOF2===========================MYC_MYB
->ICU4             --------->ANAC55(2) <-------GAMYB    <---------TGA1a                   --------->ARR11(2)
--YAB5             <---------ANAC55(2) =============================MYC_MYB              --------->KAN1
--YAB1----------->HVH21 ============================================bZIP_DOF           --------->ANAC55(2)
 
ttgaatttgctgaccaagtattaagtactttttgcaaatgagggttgaagggtattctcacatgtgtgcaatcgattgtagaaaatacttatgtattcga  24602500
                                                                                 --------->LBD16
                                                                            --------->KAN4(2)
                                                                           --------->KAN1
                                      <---------KAN1                       <---------KAN1
                      <---------RVE1(2)                                  <---------GLK1(2)   <------
                  <----------DOF2    <---------TOE1(2)                  <---------At4g35610  <------
            ---------->DOF2          <---------TOE2(2)             --------->ANAC58          -------
         <---------WOX13(2)   <---------YAB5                       --------->ANAC58 <---------KAN1
         --------->WOX13(2)   <-------TEIL                         --------->ANAC46 --------->KAN1
        <---------TOE2(3) <---------YAB1 ------->TEIL          --------->AtLEC2 --------->LBD16
 
gattgaagtttaagttaaaggctttgattttgattcatcgtatgtatcagacaactagagttgtccatccaagtcagattatcccgaatatttgtaagct  24602600
                                                      --------->HSFB2a(2)
                                                    <---------ATHB12
                                                   <---------GATA12
                                                   --------->GLK1(2)
                                                   --------->GATA12
                                                  --------->WOX13(1)
                                              --------->ANAC58
                                              --------->ANAC58
  --------->ZAT6                          <------MYB46(1)<<<<<<<ZML2                     --------->GATA12
---HSFC1(2)            <---------WOX13(2) <---------MYB46(3)            --------->MYB46(3)<------ZmHOX2a(2)
---At4g35610         <-------TEIL         <------MYB83<---------HSFB2a(2)   --------->TOE2(3)
-->HSFC1(2)      --------->MYB59        <---------MYB52(1)     --------->RVE1(2) <---------ATHB12
 
tcttgactctacaaattgtttaggtccattgaatattgaagccgttggtaagccaatctagaaccatatcaaacaacaacttcaatcgattagatcaatg  24602700
<- Previous    Next ->

AGI:  At1g66070.1   
Description:  translation initiation factor-related. similar to translation initiation factor-related [Arabidopsis thaliana] (TAIR:AT5G37475.1); similar to unknown [Populus trichocarpa] (GB:ABK92969.1); contains InterPro domain Translation initiation factor eIF3 subunit (InterPro:IPR013906)
Range:  from: 24599549    to: 24602181    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version