AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                    --------->AHL12(3)
                    <---------AHL12(3)
                    --------->AHL20(2)
                    --------->AHL20(3)
                    --------->AHL25(2)
                    <---------AHL20(3)
                   --------->YAB1
                   <---------AHL25(3)
                  --------->AHL20(2)
                <---------AHL12(2)
              <---------AHL20(3)
              --------->AHL12(3)
              --------->AHL20(2)
              <---------AHL12(3)
              --------->AHL20(3)
              --------->AHL25(2)
        --------->AHL20(2)
        <---------AHL25(3)
     <---------AHL12(2)
   --------->AHL12(3)
   --------->AHL20(2)
   <---------AHL12(3)                                                                 --------->STY1(2)
   --------->AHL25(1)                                                                 <---------ZAT2
   --------->AHL20(3)                                                                 <---------STY1(2)
   --------->AHL25(2)                                                            --------->ANAC58
   <---------AHL20(3)                    <----------DOF2                         --------->ANAC58
------------------->ANAC81 --------->TOE2(3)                    <---------AHL20(2)   --------->ANAC58
-->DOF5.7(1)  --------->AHL25(1)  <-----------GT1  --------->RVE1(2) --------->AHL20(1)           <-
->DOF2 --------->AHL20(2)<-------TEIL   <---------DOF5.7(1)     --------->AHL20(2)   --------->ANAC58
 
ccaaaaaaaaataaaaaaaaaataaaaatacatcaaatttccatcttttaagtatatcaatatttgtttaaatatgttatccattcgcaagctagtttcc  24228100
                    <------MYB46(1)
                  <---------ORA47(1)
           <---------YAB1
         <---------AHL20(2)
        --------->AHL25(3)
        <---------YAB1  <----------DOF2
       --------->AHL20(3)
       <---------AHL12(3)
       --------->AHL12(3)
       <---------AHL25(2)
       <---------AHL20(3)                                   --------->RVE1(2)
       <---------AHL20(2)                ------>MYB46(1)    --------->GATA12
     <---------YAB1 <------MYB83    <---------ARR11(2)      <---------GATA12
    --------->AHL12(2) <---------DOF5.7(1)               <---------ALFIN1        --------->ANAC58
  <---------AHL20(2)<---------DEAR3(2)   ------>MYB83   <---------ZAT14          --------->ANAC58
--------ATHB12 <---------AtMYB61    --------->ARR11(2)  <---------At4g35610 --------->ZAT14    <----
 
aatagtttatttttatttttggtcggtctttcacctatggaaccaaatgaacaatggtctgcacatccaatagcctctctacgctcgcagtcttcaagtt  24228200
                                                       <---------AHL20(2)
                                                      <---------AHL12(3)
                                                      --------->AHL20(2)
                                                      --------->AHL25(2)
                                         --------->ARR11(3)
                                         <---------ARR11(3)
                                         --------->GLK1(2)          <---------At4g35610
                                         --------->RVE1(2)      <-----------RAV1(1)
                   <---------ALFIN1  <------ZmHOX2a(1)<---------AHL25(1)
                --------->ANAC46   ----------->GT1    <---------AHL25(2)
      <---------ZAT14             --------->CCA1(2)  --------->AHL12(2)
      --------->ZAT14            <---------RVE1(2)  --------->AHL12(1)                            --
   --------->YAB1  --------->AtMYB61----------->GT1 <---------AHL12(1)                           <--
---TEIL ----------->GT1  --------->HSFB2a(2)<----------DOF2 --------->ARR11(3)         <---------YAB5
 
catcaatagtgaagtaaaaacaccactgctagaatagataggaaaatctttttgaaattttatgaccttgttgctgcgatgaaaactggaatccttgttt  24228300
                                                               <---------YAB5
                      --------->ALFIN1                   <---------YAB1
              ------>ZmHOX2a(2)                        --------->YAB1
             <------ZmHOX2a(2)                      <---------ICU4
            --------->RVE1(2)                       --------->YAB1
            <---------GATA12                       <---------YAB5
            --------->ARR11(2)                     --------->ICU4             --------->ANAC58
            --------->GATA12                      <---------WOX13(2)       <----------DOF2       <--
            <---------ARR11(2)                   ------>MYB46(1)--------->YAB1--------->ANAC58  <---
         --------->ANAC58                        ------>MYB83 <---------TOE2(3)              <------
         --------->ANAC58    ----------->GT1   <---------MYB59<---------WOX13(2)             <------MYB46(1)
<----------DOF2     <-----------RAV1(1)--------->YAB1 <---------YAB1      <---------DOF5.7(1)<------MYB83
-------->ID1<---------ARR14(2)       <------------CBF <---------YAB5  <-----------GT1      <--------
---------GT1--------->ARR14(2)      <---------ICU4--------->WOX13(2)--------->KAN1 --------->MYB46(3)
 
tttctttttgccaaggatccaaaatgttgggctcgttactaattgtaagacctaattatcatgttaatgatatataccctttcgcaacaacttggtcggt  24228400
                                    <---------YAB1
                                   <---------AHL12(3)
                                   <---------AHL25(3)
                                   <---------AHL20(3)
                                   --------->AHL25(1)           <---------AHL25(3)
                                   --------->AHL25(2)          <---------AHL25(1)
                                   <---------AHL25(1)          --------->AHL25(1)
                                <---------WOX13(2)             --------->AHL25(3)
                                --------->WOX13(2) <---------ICU4
                               --------->YAB5      --------->YAB1          ---------->DOF2
                    <---------YAB1 --------->AHL20(3)          <---------AHL25(3)
                   --------->ARR11(3)             --------->ICU4<---------AHL20(2)
                   <---------ARR11(3)            <---------AHL12(2)     --------->RVE1(2)
       <---------KAN1--------->TOE2(3)  ----------->GT1        --------->AHL20(2)                <--
<---------AtLEC2--------->AHL25(2) <---------AHL20(2)        <---------WOX13(2)                  <--
--------DOF2    <---------AHL20(3) --------->AHL20(2)        --------->WOX13(2)             <-------
------DOF5.7(1) --------->AHL20(3)--------->YAB1--------->YAB5 <---------AHL12(3)       --------->WOX13(2)
---DEAR3(2)     <---------AHL25(2)--------->AHL20(2) <---------YAB1   ------->TEIL      <---------WOX13(2)
-ORA47(1)  ------------>CBF  ------------>CBF ------------>CBF <---------AHL20(2)     ------>ZmHOX2a(1)
 
ctttcatggcatatttcaatattatcttagacaacaattaaaatagaaaaacaattatcagacaaattaaatgaatgtcaaagtaagtcctagttaagtt  24228500
                                                               --------->AHL20(3)
                                                               --------->AHL25(1)
                                                               --------->AHL20(2)
                                                               <---------AHL20(2)
                                                               --------->AHL12(3)
                                                             <---------KAN1
                                                         --------->ANAC58                          <
                                                      <---------KAN1                               -
                                                  --------->ANAC55(2)                              -
                                         <-----------GT1 <---------ANAC55(2)                      <-
      --------->KAN1                   <---------MYB52(2)<---------ANAC46              --------->RVE1(2)
   ------->TEIL                 <---------WOX13(1)--------->ANAC58             --------->YAB5 ------
 --------->ZAT18               --------->WOX13(2) --------->ANAC46            <---------YAB1 -------
 <---------ZAT18              --------->YAB5      --------->ANAC58      ------->TEIL   --------->GATA12
---------RAV1(1)             <---------YAB1    --------->ARR11(2)      <---------AtLEC2<---------GATA12
-------AtMYB61             <----------DOF2     --------->ARR14(2)<---------AHL20(3) <---------ALFIN1
--TOE2(3)  <---------YAB1<---------RVE1(2)  ------->GAMYB--------->ANAC58 <-----------HVH21---------
 
ttggtgcacctattcccattgagtcttagactttgattaacaaataaccacatacgcattacgcatataaatatgcatgtcatgactccacatccaaagg  24228600
                                           <---------AGP1
                                           <---------RVE1(2)
                                           --------->AGP1
                                           <---------GATA12
                                           <---------ARR14(3)
                                           --------->ARR14(3)
                                           --------->ARR11(3)
                            <---------AHL25(2)
                            <---------AHL25(3)
                            --------->AHL12(2)
                            <---------AHL12(2)
                            --------->AHL25(2)
                            --------->AHL20(3)
                           <---------AHL12(3)
                           --------->AHL12(3)
                           --------->AHL25(2)
                           --------->AHL20(2)
                           <---------AHL25(3)
                           <---------AHL20(2)
                           <---------AHL25(1)
                           --------->AHL25(1)
                           <---------AHL12(1)
                           --------->AHL25(3)
                           --------->AHL12(1)
                           <---------AHL25(2)
                          <---------AHL12(1)
                          <---------AHL25(2)
                          --------->AHL12(1)
                          --------->AHL25(1)
                          <---------AHL20(1)
                          --------->AHL25(3)
                          <---------AHL25(1)
                          --------->AHL25(2)
                <----------DOF2            <---------ARR11(3)
           --------->MYB46(3)      --------->GATA12
         ----------->RAV1(1)<---------AHL20(3)
      --------->ANAC46    --------->AHL20(2)       --------->ANAC58
      --------->ANAC58    <---------AHL20(2) ------>ZmHOX2a(2)                                     <
    ---------->DOF2       --------->AHL12(3)<------ZmHOX2a(2)                                     <-
---------ARR14(2)        --------->AHL12(2)<---------ARR14(2)                              <--------
-------->ARR11(3)      <---------AHL20(2)  --------->ARR14(2)                            <---------YAB5
-------->ARR14(2)   --------->TOE2(3)  ---------->DOF2---------->DOF2                   <---------AHL12(2)
-----ZmHOX2a(1)<---------DOF5.7(1) <---------GATA12--------->ANAC58                     --------->WOX13(2)
--->DOF5.7(1)  <---------ICU4<---------YAB1--------->GATA12                             --------->AHL12(2)
-->DOF5.7(1) --------->GLK1(2) <-----------GT1   ---------->DOF2            <---------ARR11(3)   <--
->DOF2--------->ANAC58 --------->AHL20(2) --------->RVE1(1)           >>>>>>>>>TBF1     <---------WOX13(2)
 
aggaacttgaagcaacaatcttttcttaaattattttcgatctaaagatcttgaaagcaaagttgatttcgaagaagaagataacttcgctaattatctg  24228700
     <-------GAMYB
    <-----------RAV1(1)                   --------->ANAC58           --------->At4g35610
----------DOF2<<<<<<<<<TBF1     <---------HSFB2a(2)                  --------->GLK1(1)
--------DOF5.7(1)     <---------ATHB12<---------RAP2.6(3)           --------->ARR11(3)
---GT1<---------MYB52(1) <---------ANAC46 --------->ANAC58          <---------ARR11(3)         <----
----------------------ANAC81    --------->HSFB2a(2)           --------->ALFIN1      --------->MYB46(3)
 
ttcttttctgttgtttcttcttccaatcgcgttttctaggccgataagaaacttagatggaccaagtggaagagctccaactgttcaacaaataagaaac  24228800
                                    <---------YAB1
                                  --------->ATHB12
                                 --------->ICU4
                             ------->GAMYB
                          --------->MYB52(1)
                         <---------WRKY38(1)
                         <---------WRKY12                                                         <-
                      --------->ZAT18         <---------GLK1(2)    --------->YAB1                 --
--------->TOE1(2)     <---------ZAT18   <---------ZAT6         <------ZmHOX2a(1)                 <--
--------->TOE2(2)<---------RVE1(2)--------->KAN1        --------->ZAT18                          <--
-----MYB52(2)  ----------->HVH21 <---------YAB1   --------->HSFB2a(2)<---------YAB1   ---------->DOF2
 
aaacatgggactagagaggtgatagtggacaacgggattattagtgtcagtttctcgagtccccaaggacttataactggcatcaaatacaaaggagtca  24228900
                                                                                      --------->ANAC58
                                                                                      --------->ANAC46
                                                                                      --------->ANAC58
                                                                                    <---------ALFIN1
                          <---------HSFB2a(2)                               >>>>>>>>>RAP2.2
           <---------ALFIN1                 <---------ARR11(2)            --------->RVE1(2)
         --------->AtLEC2 --------->HSFB2a(2)------>NtERF2               <---------CCA1(2)
--------ICU4          --------->ZAT2        --------->ARR11(2)       <----------DOF2--------->MYB52(1)
------->YAB1        ------->GAMYB         --------->LBD16           <---------DOF5.7(1)
-------ATHB51 --------->RVE1(2)         <---------LBD16         <-----------GT1   --------->AtMYB61
-------ATHB12--------->ANAC46 <---------ARR14(2) --------->AtLEC2------->TEIL  --------->ANAC46
 
ataatgttctccatccacatcaacgagctcgagaatactttgtaccggagccatacaagaacacaatgaaccctttatatctaaaccacacggacaagtt  24229000
<- Previous    Next ->

AGI:  At1g65210.1   
Description:  similar to lyase [Arabidopsis thaliana] (TAIR:AT4G38030.1); similar to Os08g0554100 [Oryza sativa (japonica cultivar-group)] (GB:NP_001062464.1); similar to putative MYST1 [Oryza sativa (japonica cultivar-group)] (GB:BAD10227.1); similar to hypothetical protein OsI_029185 [Oryza sativa (indica cultivar-group)] (GB:EAZ07953.1); contains InterPro domain Galactose-binding like (InterPro:IPR008979); contains InterPro domain Rhamnogalacturonate lyase (InterPro:IPR010325)
Range:  from: 24228475    to: 24229478    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version