AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                <---------YAB1               --------->ARR14(2)
              --------->YAB1                 --------->GATA12
              --------->YAB5                 <---------GATA12
             --------->ICU4                  --------->ARR11(2)
     --------->ANAC58                        <---------ARR11(2)
     --------->ANAC58                       --------->KAN1
     --------->ANAC46                    <---------At4g35610                                 -------
  --------->TOE1(2)             --------->ZAT2   --------->TOE2(3)              --------->ANAC58
  --------->TOE2(2)            --------->ANAC58 ----------->GT1                 --------->ANAC58
>DOF5.7(1)--------->DOF5.7(1)  --------->ANAC58<-------TEIL   --------->WRKY18(1)         <---------ETT(2)
gaaaacatacgaaaaaatgatgagaaaaactcacaagcttggatagcagattcgttaataattcgttcaagcgtctcaaacacaagcttactgtccacga  21633300
                                                         <---------DOF5.7(1)       <---------ANAC58
                                                        <---------DOF5.7(1)        ----------->GT1
                                                        <----------DOF2            <---------ANAC58
                                                        <---------DAG2       ------>ZmHOX2a(2)
                                             <-------GAMYB                  --------->GLK1(1)
                                            ------>ZmHOX2a(2)              --------->GATA12
                                            <---------MYB46(3)         ----------->RAV1(2)
                                           <------ZmHOX2a(2)           --------->ANAC55(2)  <-------
                                          --------->ARR11(3)         <-----------GT1       <--------
                       --------->KAN1     <---------ARR11(3)      <----------DOF2  <---------ANAC46
-->ANAC46         ----------->GT1         --------->GATA12  ---------->ID1 <---------ARR11(3) ------
gaaacttcaagtacccttcgattgtgaaattccatgttgatacaagatcgttggagtcactttttccttcttttacctgatctcttgggtgaattttcat  21633400
                                                 <----------DOF2  --------->ZAT2
                                                <---------DOF5.7(1)  <---------At4g35610
               ------>ZmHOX2a(1)          --------->GLK1(1)       <---------ZAT2                   -
    ------->TEIL                          <---------GLK1(1)       --------->At4g35610             --
 --------->ANAC58                        --------->ARR11(2)       <---------At4g35610             <-
 --------->ANAC46                        <---------ARR11(2)      <-----------RAV1(1)              <-
 <---------MYB52(2)                      <---------ARR14(2)    ----------->RAV1(2)        ----------
 --------->ANAC58   --------->AtMYB61    --------->ARR14(2)    =======================RAV--------->AtMYB61
--YAB1    <---------At4g35610           <------ZmHOX2a(1)      ==========================RAV      --
---GT1--------->TOE2(3)            --------->HSFB2a(2)  <---------ANAC58  ----------->RAV1(1)     <-
--->WOX13(2)  --------->ANAC46     <---------HSFB2a(2)  <---------ANAC58------>NtERF2--------->MYB46(3)
taccacgaacctcatctcctccacaaacccattcggttctcgaggataccttctttctggcttctcccctgctgctgccacaacattcaccaccaaagtc  21633500
          <----------DOF2          --------->At4g35610
------>ZmHOX2a(2)                 --------->ALFIN1
-------->KAN1                    <------ZmHOX2a(1)              <-----------GT1
------->GATA12                 --------->ALFIN1       --------->RVE1(2)
--------GATA12               <---------ANAC46         <-----------ARR10
--------ARR11(3)             <---------O2             --------->ARR11(3)
>DOF2<---------MYB52(1)     <------NtERF2             <---------ARR11(3)            ----------->HVH21
------->ARR11(3)           ------>NtERF2             <---------CCA1(2)    --------->At4g35610
--------RVE1(2)           <----------ID1           <---------KAN1         <---------At4g35610
tgatcttcgtttgctcttcggacaagatggcgacgaggagcggctatggtccgaacatatcttattgtcactgtcttagctctcagactgacatagctct  21633600
                       --------->DOF5.7(1)                                    --------->ANAC58
             <---------ANAC58                                                 --------->AtLEC2
             <---------ANAC58                                                 --------->ANAC46
            <---------At4g35610                                               --------->ANAC55(1)
           <---------YAB1<----------ID1                                       --------->ANAC58  ----
         <---------At4g35610                                                  <---------ANAC55(2)
 --------->WRKY18(1) ---------->DOF2                           ------------>CBF       ------------>CBF
<-----------HVH21   <------ZmHOX2a(1)           <---------REM1(1)      --------->WOX13(2)  ---------
cgcagtcaagtcttctgcttgcaggaaagcggcaagaggcattaagtcttgatgtagccatgagtttgcaatctaatagacacgcaaactgcaatatgaa  21633700
                           <---------ZAT6              <---------MYB52(1)
                           ----------->GT1             --------->DOF5.7(2)         ---------->DOF2
                --------->YAB5                   --------->SPL7(1)              <---------WOX13(2)
<---------TOE2(3)      <------ZmHOX2a(1)     ---------->ID1                     --------->WOX13(2)
<---------TOE1(3)    <---------TOE2(3)   <----------DOF2--------->WRKY38(1)    <---------TOE2(3)
----->WOX13(2) --------->DOF5.7(1)     <---------YAB5 --------->At4g35610  <----------DOF2         <
>RVE1(2)     ---------->DOF2    <-----------TBP<---------SPL7(1)     ---------->DOF2     <----------DOF2
attagggtttgtaagagaaagactaaggaagtgttatatatagtctttgtcgtaagccgttgactagacaaataaagtctttaagttaaagactttaata  21633800
                                                                         <---------HSFB2a(1)  <-----
                                ---------->DOF2                   --------------------->WRI1 -------
                               <---------AHL20(2)             <----------ID1             <---------HSFB2a(1)
                              <---------AHL20(2)             --------->SPL7(1)    --------->TOE1(2)
    ------->TEIL            <---------WOX13(2)             <---------SPL7(1)     --------->YAB1
<-------MYC3                --------->WOX13(2)            <---------ANAC58     <---------GATA12  ---
------->MYC3              --------->AHL20(2)        <---------WRKY38(1)  <---------HSFC1(2)<--------
<-------MYC2              <---------AHL20(2)       ------------>CBF   ---------->DOF2--------->DOF5.7(1)
------->MYC2            <----------DOF2--------->ICU4     <---------ANAC58     --------->GATA12<----
---------ANAC46 <----------DOF2--------->AHL20(2)  <---------YAB5 ---------->DOF2------>ZmHOX2a(2)<-
gaacgtgtatgtagtcttgcattaagtctttaatttaaagacattatttgtctagtcaatggcttacgacaaagaaagcttcgatcgtaagatggttcgg  21633900
            --------->DEAR3(1)                                    <---------ANAC55(2)
            ====================MYC_MYB                           --------->ANAC46
           --------->MYB46(3)                                     --------->ANAC58
           --------->ATERF1(1)                                    --------->ANAC58   --------->DOF5.7(1)
           <------NtERF2                                          ----------->GT1  ---------->DOF2
    --------->KAN1------>NtERF2                           --------->SPL7(1)      <---------YAB1
------------>CBF--------->LBD16                         --------->TOE2(2)  <---------YAB1--------->YAB5
-MYB83--------->ANAC46<---------TGA1a                   --------->TOE1(2)  --------->AHL20(2)
----DEAR3(2)<---------ALFIN1                            <---------SPL7(1)  --------->AHL25(3)      -
>ARR11(2)  --------->DEAR4(2)  --------->AHL25(2)      <---------ANAC46    <---------AHL20(2)      <
-MYB46(1)  --------->DEAR3(2)  --------->AHL20(3)      --------->ANAC55(2) --------->AHL25(1)      <
-->MYB59  <---------ATERF1(1)  --------->AHL20(2)      <---------ANAC58    <---------AHL20(3)  <----
------>SPL7(1) <---------ALFIN1<---------AHL20(3)      <---------ANAC55(2) --------->AHL20(3) ------
-ARR11(2) ------>NtERF2 ----------->HVH21              <---------ANAC58--------->ANAC55(2)   -------
-------HVH21--------->AtMYB61  <---------AHL25(2)     --------------->AtSPL3     <---------TOE2(3) -
--------ETT(1)--------->ATERF1(1)--------->YAB1       <---------TOE1(2)<---------ANAC55(2)----------
tccgacaatatgccaccgccgcgccacttgacaaaataatagaagtactcttggtcttacgtacgaagcacgttacatattattaagaaagaagattagg  21634000
       ---------->DOF2                       <--------HAHB4
  --------->AHL25(2)                         <--------ATHB1
  <---------AHL25(1)                         <---------ICU4
  <---------AHL12(3)                --------->WOX13(2)
  --------->AHL25(1)           --------->GLK1(2)
  --------->AHL20(2)           --------->ARR14(2)
  <---------AHL20(2)           <---------ARR14(2)       --------->YAB1
  --------->AHL20(3)           <-----------ARR10    <---------AHL12(1)
  <---------AHL20(3)           --------->RVE1(2)<---------AHL20(2)
  <---------AHL25(3)           <---------ARR11(3)   --------->AHL12(1)
 --------->AHL20(2)        --------->YAB1   <---------ATHB51
 <---------AHL25(3)    <---------SPL7(1)    <---------ATHB12
-------->WOX13(2)     --------->ANAC55(2)   --------->AHL20(2)
---------AHL12(2)     <---------ANAC55(1)   --------->AHL25(3)
---------WOX13(2)     <---------ANAC58      --------->ICU4
--ZmHOX2a(1)          <---------ANAC58    --------->YAB1--------->YAB5
----->GT1      --------->YAB1 <---------GLK1(2) --------->AHL20(2)                               ---
-->MYB59--------->DAG2<---------ANAC55(2)--------->ZAT6 <---------ICU4                       <------
-------->AHL12(2)   <---------TGA2(2)   <---------TOE2(3) <---------YAB1           ----------->GT1
-------------->ANAC81 <---------ANAC46 <-----------GT1--------->ARR11(3)         --------->DOF5.7(1)
aaaattaaaataaagctataatatgacgtatgagaatcttattaacaataattaaaaaatcatgaatagagagaatagactaagaagagcaaaaaaacta  21634100
                           --------->AHL25(1)              --------->WOX13(2)
                           <---------AHL25(1)              <---------WOX13(2)
                           --------->AHL25(3)            <---------AHL20(2)
                      --------->AHL20(1)                --------->AHL12(3)
                      <---------AHL20(1)                <---------AHL20(2)
                      --------->AHL20(3)                --------->AHL20(2)
                      <---------AHL20(2)                <---------AHL12(3)
                      --------->AHL25(3)                <---------AHL25(3)
                      <---------AHL25(3)                --------->AHL25(1)
                      <---------AHL25(2)                --------->AHL25(3)
                      --------->AHL25(2)                <---------AHL25(1)
                      --------->AHL25(1)             <---------WOX13(2)
                      <---------AHL25(1)             --------->WOX13(2)
                      <---------AHL20(3)           <---------AHL20(2)
                     --------->AHL20(2)            --------->AHL25(3)
                     --------->AHL25(1)           --------->AHL20(2)
                     <---------AHL12(3)           <---------AHL20(2)
                     --------->AHL12(3)           <---------AHL12(3)
                     <---------AHL25(1)           --------->AHL12(3)
                     --------->AHL25(3)           --------->AHL25(2)      <---------WOX13(1)
                     --------->AHL12(1)           --------->AHL25(1)     --------->WOX13(2)
                     <---------AHL12(1)           --------->AHL25(3)     <---------WOX13(2)
                     <---------AHL25(3)           <---------AHL25(2)   <---------AHL20(2)
                     <---------AHL20(2)        <---------AHL12(2)      <---------YAB1
                     --------->YAB1           <---------AHL12(3)      <---------AHL25(1)
                   --------->AHL12(2)         --------->AHL12(3)      --------->AHL25(1)
                   <---------AHL20(3)         --------->AHL12(2)      <---------AHL12(3)
                   <---------AHL12(2)         <---------AHL25(2)      --------->AHL20(2)
                   --------->AHL25(2)        --------->AHL20(2)       --------->AHL12(3)
                   --------->AHL20(3)    <XXXXXXXXXXXXXXXXXXXXMIR1888 <---------AHL20(2)
              ----------->GT1 <---------WOX13(2)  <---------AHL25(1)  <---------AHL25(2)           -
------->DOF2<---------LBD16--------->AHL20(3)<---------AHL20(2)       --------->AHL25(3)           -
----ID1    <---------ANAC46<---------AHL20(3)--------->AHL25(3)       --------->AHL25(2)           <
caaagtgttcaattttgtggaaaattatattttaatttacattttttataaattttaatttaaattgacaaattttaattgaattctagtctacattttt  21634200
<- Previous    Next ->

AGI:  At1g58300.1   
Description:  HO4 (HEME OXYGENASE 4); heme oxygenase (decyclizing)/ oxidoreductase. similar to HO3 (HEME OXYGENASE 3), heme oxygenase (decyclizing) [Arabidopsis thaliana] (TAIR:AT1G69720.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65667.1); contains InterPro domain Haem oxygenase-like, multi-helical (InterPro:IPR016084); contains InterPro domain Heme oxygenase (decyclizing), plant (InterPro:IPR016951)
Range:  from: 21631677    to: 21633661    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version