AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         <---------ARR11(2)                              <------ZmHOX2a(1)
         <---------ARR14(2)                          --------->TOE1(2)
         --------->GLK1(2)                        <---------ARR11(2)
 --------->WOX13(2) <---------ZAT18        <---------WOX13(2)
 <---------WOX13(2) --------->ZAT14        --------->WOX13(2)                              ---------
--------->WOX13(1)  <---------ZAT14     <---------------AGL15              --------->YAB1 <---------ANAC46
------TEIL        --------->At4g35610   --------------->AGL15            <---------WOX13(2)---------
--->DOF5.7(1)------>ZmHOX2a(1)         ----------------->AGL1            --------->WOX13(2)<--------
-->DOF2  --------->ARR14(2)   --------->At4g35610 <---------ARR14(2) --------->TOE2(3)   <---------LBD16
attcaattagagaatcctatcagttcacctataagctaagtttcgaaattgagaaaccgaggaagaccaaaaacttaataagaacagtaggctacgggaa  20898900
                                                                            <---------GLK1(1)      -
                                                                            --------->KAN1        --
                                                                            --------->GLK1(1) ------
                                                                           <---------RVE1(2)  ------
                                                                     --------->At4g35610 --------->RAP2.6(2)
                                                                     <---------ZAT2     --------->DEAR3(2)
                                                                  <---------At4g35610   --------->MYB46(3)
                               <----------DOF2                    --------->At4g35610  <---------ATERF1(1)
                     --------->DOF5.7(1)                         <-----------RAV1(1)  <---------ARR14(2)
        --------->DOF5.7(1)<---------KAN1        <---------At4g35610 --------->ZAT2   --------->ARR14(2)
--------->KAN1      --------->DOF5.7(1)  <------MYB83         --------->GATA12        --------->ARR11(2)
>LBD16---------->DOF2--------->DAG2      <------MYB46(1)      <---------GATA12        <---------ARR11(2)
>HSFB2a(2)         ---------->DOF2      --------->ALFIN1      --------->ARR14(2)     <------ZmHOX2a(1)
-HSFB2a(2)       --------->AtMYB61      <---------AtMYB61    <---------GLK1(1)   --------->LBD16 <--
acaacattcgaaagagaagaccaaaagggaatttctttagagggtggtatcgagcttactcttgaaatctgctgctgtgatatccagaggaaccgccatg  20899000
             <---------STY1(2)                                                <---------ARR14(2)
     <---------GLK1(1)                                                        --------->ARR14(2)
---------ARR11(2)        ---------->DOF2                                      --------->GLK1(2)
---------ARR14(2)      --------->At4g35610                            --------->ALFIN1  ------>ZmHOX2a(1)
-------->ARR14(2)      <---------At4g35610                        --------->ZAT14 <------MYB46(1)
------->YAB5 --------->STY1(2)                                    <---------ZAT14 <------MYB83
----->TGA1   <---------ZAT2--------->DOF5.7(1)           <---------ANAC58<---------ANAC46
----->HVH21 --------->ANAC58                             <---------ANAC46<---------ANAC58
-AtMYB77    --------->ANAC58    --------->At5g28300      <---------ANAC58<---------ANAC58  <--------
-------YAB1 --------->ANAC46   ----------->GT1   --------->RVE1(2)--------->ZAT18--------->MYB59
acgattcgagttcccaagctagtctcagcaaagacagtaacttcttctgcaatagccattgtgtgagagagcagtggcgagaatttggttcctgttgttg  20899100
          --------->AHL25(3)                                               --------->ANAC58
          --------->AHL25(2)                                             --------->MYB52(1)
          <---------AHL25(1)                                        --------->TOE1(2)
          <---------AHL25(3)                                  <---------AHL12(2)
   ----------->GT1                                            --------->WOX13(2)
   --------->LBD16             --------->ANAC46               <---------WOX13(2)
  <---------HSFB2a(2)          --------->ANAC58              <---------AHL20(2)
  --------->HSFB2a(2)--------->ANAC46                       --------->AHL20(2)
 <---------LBD16--------->ANAC46         <----------ID1     --------->AHL25(3)<-----------RAV1(2)
-MYB46(3) <---------AHL25(2)   --------->ANAC58             --------->ICU4 --------->ANAC58
ttcatcgggaaaataaaatacatcacgctgtttcaagtcatgttaagacaaatgtttgcagtatttattaacctagaaacggcaggctgtgcaagtgtat  20899200
                         --------->ARR11(2)              <----------DOF2
                      <---------------AtSPL3     <----------DOF2
                      --------------->AtSPL3    <---------DOF5.7(1)
                    --------->MYB52(1)   --------->ICU4 <---------DOF5.7(1)                <--------
                 --------->ANAC46  <---------LBD16     <---------DOF5.7(1)          --------->DOF5.7(1)
               <-----------GT1<---------MYB52(1)<---------ICU4                  --------->TOE1(3)<--
    --------->DOF5.7(1)  <---------ARR11(2) <---------YAB5            *TSS      --------->TOE2(3)<--
atttcgaaagactgaaattcacaaaacggtaccgtttcctcggaatcatcatctttccctctttccttccaccgagagcaaaacctaaaaatggtcgttt  20899300
                                     --------->ANAC58                                   ----------->HVH21
                                     --------->ANAC58                                <---------ANAC46
                                   --------->KAN1                                    <---------DEAR3(1)
                                <------NtERF2                                       --------->ATERF1(1)
                               --------->LBD16                                      ------>NtERF2
                               <---------ATERF1(1)                                  <------NtERF2
                               ------>NtERF2                                        <---------At4g35610
                               <---------DEAR3(2)                                   <---------LBD16
                              --------->RRTF1(2)                                   ------>NtERF2
                              --------->DREB2C(2)                                 <---------RRTF1(2)
                              <---------ATERF1(2)                                 <---------RAP2.3(2)
                              --------->RAP2.3(3)                                 <---------DEAR3(1)
                              --------->ATERF1(2)                                --------->At4g35610
                              <---------DEAR3(1)                                 <---------At4g35610
                              --------->DEAR3(1)                                 <---------LBD16
                              --------->RAP2.3(2)                               <-----------RAV1(1)
                             --------->ORA47(2)                               ----------->RAV1(2)
                             <---------LBD16                                  ------>ZmHOX2a(1)
                             --------->ERF1                              <---------At4g35610 <------
                             <------NtERF2                               --------->At4g35610--------
                             --------->ATERF1(1)                         <---------ZAT2 <---------ARR11(2)
                             --------->RAP2.3(1)                     <-----------HVH21 <------NtERF2
                            <---------ATERF1(1)                    --------->At4g35610<---------ATERF1(1)
-MYB46(3)                   <---------RAP2.3(1)                    <---------At4g35610--------->LBD16
-------GLK1(2)         ---------->DOF2         <----------DOF2  --------->At4g35610<---------RRTF1(1)
-------RVE1(2)         --------->KAN1--------->ANAC46           <---------At4g35610<---------RAP2.3(1)
gattctctctctctctctccgttcaaaaatgcgccggcacaagcgatggcctttgaggtctcttgtctgcagcttcagctcctctgcggcggagacagtt  20899400
                     <---------O2 <-------GAMYB
                  --------->DEAR3(1)                                            ------>ZmHOX2a(2)
                 --------->At4g35610                                          <---------ARR11(3)
                 <---------At4g35610                                          --------->ARR11(3)
           <---------At4g35610    --------->LBD16                             <-----------ARR10
           --------->At4g35610   <---------ANAC46                           <---------YAB5
           <------NtERF2<---------RAP2.6(2)                                <---------WOX13(1)
           --------->ZAT2------>NtERF2       ----------->HVH21        --------->At4g35610       ----
->AtMYB77  <---------ZAT2<---------RAP2.3(1)<-------MYC3          ----------->HVH21           ------
-GAMYB--------->ANAC46<---------ATERF1(1)   ------->MYC3      <---------HSFB2a(2)             ------
--->GT1------->GAMYB--------->ATERF1(1)    <---------KAN1     --------->HSFB2a(2)      --------->KAN1
actacttcaacggcagcttcagcgacggcggcttttccgttgaagcatgtgacaaggtcgaacttcgagacgacgctgaatgatctacgctcactcgtaa  20899500
                   <---------WRKY18(1)                                                    --------->ARR11(2)
                  ----------->HVH21                                                      <---------At4g35610
                  --------->WRKY12                                                       --------->At4g35610
                 <---------WOX13(1)   ----------->HVH21                               --------->TGA2(2)
                ==============================MYC_MYB                                <-----------TGA1
         <---------ANAC46           <---------ANAC58                                 <-----------HVH21
         <---------ANAC58           <---------ANAC46                                ================
      --------->GLK1(1)             <---------ANAC58  <------NtERF2                 --------->TGA1a
     --------->GATA12               --------->TGA1a  --------->REM1(2)              --------->O2
     --------->ARR14(2)             <---------bZIP60(1)<---------ANAC58             <---------bZIP60(1)
     <---------GATA12               --------->bZIP60(1)<---------ANAC46             --------->bZIP60(2)
     <---------ARR14(2)             <---------bZIP60(2)<---------ANAC58             --------->bZIP60(1)
 --------->At4g35610                <---------O2    --------->ALFIN1                <---------TGA2(1)
 <---------At4g35610                <---------TGA1a--------->LBD16                  <---------O2
 <------NtERF2<---------ANAC46      --------->O2  <---------ANAC46                  ================
----->DOF5.7(1) <-------GAMYB----------->HVH21    <---------ANAC58              --------->SPL7(1)---
--->ARR11(2) <------NtERF2 --------->At4g35610    <---------ANAC58  <---------ZAT6  <---------TGA1a
---->DOF2<---------ANAC58  <---------At4g35610--------->ZAT18   ------>ZmHOX2a(1)   --------->TGA2(1)
aggctgcagatttcgtggcgattgaccttgagatgactggcgtgacaagcgctccgtggcgagactccttagagttcgaccgctacgacgtcagatacct  20899600
                                       <------MYB83          --------->ARR11(2)
                                       <---------ANAC58      <---------ARR14(2)
               --------->LBD16         <------MYB46(1)       <---------RVE1(2)
               ------>NtERF2           <---------ANAC58--------------------->WRI1       -------->P
              --------->DEAR3(1)      <---------AtMYB61<-------GAMYB                    ------>MYB83
         <---------ATERF1(1)          --------->MYB111(2)    --------->ARR14(2) <---------ANAC58
   ---------->DOF2          <------NtERF2             <---------ANAC58      --------->KAN1     -----
--->TOE2(3) ------>NtERF2  ------>NtERF2           <----------DOF2--------->TOE2(1)     ------>MYB46(1)
--->TOE1(3)--------->DEAR3(1)         --------->MYB46(2)<---------MYB52(1) <---------ATHB12  <------
========bZIP_DOF          --------->DEAR3(1)      <---------DOF5.7(1)      <---------YAB5  ---------
========bZIP_DOF   --------->KAN1   <---------MYB52(1)<---------ANAC58 <---------YAB5  ------>ZmHOX2a(1)
------->DOF2--------->LBD16<-----------HVH21   ---------->ID1<---------GLK1(2)  <---------ANAC58
caaagtcaaagactccgccgagaaattcgccgtcgttcagtttggtgtctgtccctttcgttgggattctcgtactcagtcattcgtgtcctacccgtta  20899700
         <----------DOF2                                       --------->ATERF1(1)
   <----------DOF2       --------->WOX13(2)                    <-----------RAV1(2)
  <---------DOF5.7(1)    <---------WOX13(2)--------->MYB52(1) <------NtERF2              <----------
---->MYB52(2)  <----------DOF2       --------->WRKY45         --------->ATERF1(1)      =============
---MYB52(1)   <---------DOF5.7(1)    --------->WRKY38(1)     ------>NtERF2  <----------DOF2    <----
>ANAC46 <---------DOF5.7(1)        <----------DOF2          <---------RAP2.3(3)        ------>ZmHOX2a(1)
gtctctctttctctttctctttagcttcaattgtgtagctttgactaaacgggtctcgttttgggggcaggcacaatttctttgtatttcctcgtcaaga  20899800
<- Previous    Next ->

AGI:  At1g55860.1   
Description:  UPL1 (UBIQUITIN-PROTEIN LIGASE 1); ubiquitin-protein ligase. Identical to E3 ubiquitin-protein ligase UPL1 (UPL1) [Arabidopsis Thaliana] (GB:Q8GY23;GB:Q9LG27;GB:Q9M7K7); similar to UPL2 (UBIQUITIN-PROTEIN LIGASE 2), ubiquitin-protein ligase [Arabidopsis thaliana] (TAIR:AT1G70320.1); similar to putative ubiquitin-protein ligase 1 [Oryza sativa (japonica cultivar-group)] (GB:BAD22340.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45141.1); similar to hypothetical protein OsJ_027403 [Oryza sativa (japonica cultivar-group)] (GB:EAZ43920.1); contains InterPro domain Armadillo-type fold; (InterPro:IPR016024); contains InterPro doma
Range:  from: 20883132    to: 20899059    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g55870.1   
Description:  AHG2/ATPARN; ribonuclease. Identical to Poly (PARN) [Arabidopsis Thaliana] (GB:Q9LG26;GB:Q4W7J2); similar to CAF1 family ribonuclease [Arabidopsis thaliana] (TAIR:AT3G25430.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN76999.1); contains InterPro domain Polynucleotidyl transferase, Ribonuclease H fold; (InterPro:IPR012337); contains InterPro domain Ribonuclease CAF1; (InterPro:IPR006941)
Range:  from: 20899271    to: 20902087    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version