AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                  <-
                                                                                                  <-
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                             <------
                                                                                             <------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                  <---------ANAC46                          <-------
                                                  --------->ALFIN1                          <-------
                  --------->LBD16      <---------REM1(1)                                    <-------
                <---------LBD16        <-----------RAV1(1)                              <-------GAMYB
             <---------At4g35610       <---------MYB46(3)                              --------->MYB52(2)
             <---------ABI4(2)      <---------MYB46(3)                         --------->MYB46(3)<--
             --------->At4g35610 <-----------RAV1(1)                   <---------ANAC58<---------DEAR3(2)
             --------->ZAT18    <------------AtMYB77      <---------YAB5 --------->ALFIN1   <-------
             --------->ZAT14   ------>MYB46(1) <---------DEAR3(1)      <---------ANAC46<---------MYB46(3)
       <------ZmHOX2a(1)       ------>MYB83<---------At4g35610         <---------ANAC55(1) <--------
 <-------GAMYB<---------ALFIN1--------->MYB52(1)<---------ANAC46       <---------ANAC58<-----------RAV1(1)
---->KAN1    <---------ZAT14--------->MYB46(3)<---------LBD16         <-----------------------TaNAC69(2)
 
atgctgttgaggagtctgcaccggagtttgaaccaactgttgttgttgctgcggtgtatgcatcatagattgaggcgtgtgaaccatcgtctgttgcggc  20557500
--------AtMYB61
--------DEAR3(1)
-----ANAC46
-----DEAR3(1)
---->ALFIN1
--->ATERF1(1)
-NtERF2
>NtERF2
----At4g35610
----LBD16
---RRTF1(1)
---RAP2.3(1)
--DEAR3(1)
--RAP2.6(2)
--RAP2.3(2)
--RRTF1(2)
--ANAC58                                 ------->GAMYB
--RRTF1(3)                              --------->MYB46(3)                      --------->ALFIN1
--RAP2.3(3)                             <---------MYB52(2)          <---------MYB46(3)   <---------MYB46(3)
--ANAC58                   <------ZmHOX2a(1)  <---------MYB52(1)    <-----------RAV1(1)<-------GAMYB
----NtERF2    <-----------RAV1(1)  ----------->GT1   <---------MYB46(3) <---------MYB46(3)
--ANAC46  --------->MYB46(3)  <------ZmHOX2a(1)<---------MYB46(3) <-------GAMYB <-----------RAV1(1)
-LBD16  <-----------GT1--------->DOF5.7(1) --------->MYB46(3)    <-----------RAV1(1)  <-----------RAV1(1)
 
ggaggtgattgtaacgactgtggctgaagaggaggagattgtaacaaccgttgttgttgttggaattgctgttgttggatgaagtgttgctgttgttgga  20557600
                                                              <-------GAMYB
                                                             <-----------RAV1(1)
                                                             <---------MYB46(3)
                                                         <---------ANAC58
                                                         <---------ANAC46
                                                         <---------ANAC58
                                                     --------->At4g35610
                                              <---------REM1(1)
                                              <---------MYB46(3)<---------MYB46(3)
                                              <-----------RAV1(1)
              <---------CCA1(2)        <---------YAB5<---------At4g35610
             ------->TEIL        <---------ANAC58    --------->ZAT2
       <-----------RAV1(1)       <---------ANAC58    <---------ZAT2
   --------->ARR11(3)            <---------ANAC46   <-----------RAV1(1)              <-----------RAV1(1)
   <---------RVE1(2)          <---------RAP2.6(2)  <---------RAP2.6(2)            ------->TEIL
<---------ANAC46            <-----------RAV1(1)   <---------At4g35610 <---------MYB46(3)<---------MYB46(3)
 
attgctgatattgttgcatctcttgttgttgttgtggctggaattgttgttgttgctgctgcgtctgttgttgttgttgaagatgaaactgttgttgttg  20557700
                                                                                                 ===
                                                                                                 ===
                                                                                                 ===
                                                                                          ----------
                                                               <---------ZAT14           <-------MYC3
                             <---------ANAC58              <---------DEAR3(1)            ------->MYC2
                             <---------ANAC46       --------->KAN1                     ------->TEIL
                             <---------ANAC58       --------->YAB5          <---------ANAC58     <--
                        <---------REM1(1)          --------->ICU4           <---------ANAC58     <--
                        <---------MYB46(3)         <---------YAB1        <-----------GT1 <-------MYC2
                        <-----------RAV1(1)        <---------YAB5------->TEIL         <---------ALFIN1
                     <-----------RAV1(1)    <---------ANAC58   <---------SPL7(1)  ----------->RAV1(2)
                    <---------YAB5          <---------ANAC46   --------->ZAT14   <---------RAP2.3(1)
                    --------->ICU4          <---------ANAC58<---------DEAR3(2)   ------>NtERF2  <---
                 <---------YAB1    <------ZmHOX2a(1)--------->ATHB12   --------->HSFC1(2)------->MYC3
 
ttgttgttgttgttgttgttgtaattgttgttgctggaggaatagttgctggtcatgattcgtcggtgtaccgaagttaccttgcgcctgcacgtttggg  20557800
                                                                                  <------NtERF2
                                                                                <---------DEAR3(1)
                                                                               --------->ATERF1(1)
                                                     ------>ZmHOX2a(2)         <------NtERF2
                      --------->LBD16                =====================HOX2a_HOX2a
                      =====================================HOX2a_HOX2a        <---------ATERF1(1)
                      ==================HOX2a_HOX2a ======================HOX2a_HOX2a
                      ------>ZmHOX2a(1)             <------ZmHOX2a(2)         ------>NtERF2
                    ----------->RAV1(2)            <---------GATA12          --------->DEAR3(1)
                   =====================HOX2a_HOX2a--------->GATA12         --------->RAP2.3(1)
                   ------>ZmHOX2a(1)          =============HOX2a_HOX2a      --------->ATERF1(1)
       --------->WOX13(2)                     ------>ZmHOX2a(1)             <------NtERF2  <--------
=============================HOX2a_HOX2a      ==============HOX2a_HOX2a    ------>NtERF2  --------->YAB1
==========================HOX2a_HOX2a     <-----------GT1                  <---------ATERF1(1)
=======================HOX2a_HOX2a      <-----------GT1        <-----------GT1<-----------HVH21
----------->WRI1  <---------ALFIN1   <---------DOF5.7(1)   --------->KAN1  <---------RAP2.3(1)
-------YAB5     ------>ZmHOX2a(1)====================HOX2a_HOX2a   ------>ZmHOX2a(1)    <---------WOX13(2)
----ZmHOX2a(2)  ========================HOX2a_HOX2a--------->ARR14(2)     --------->DEAR3(1)       -
------RVE1(2)  <---------ALFIN1  ------>ZmHOX2a(2) <---------ARR14(2)     <---------DEAR3(1)   -----
 
atcatcgaccaattacctcctcctcctgagaattgatccattttttctccttccgatctcgctaattctccttctcgtcgccgtcgtcgtctattaaaac  20557900
                                                                                <---------YAB5
                                                                                <---------YAB1
                                                                                --------->ICU4
                                                                                ----------->GT1
                                                                         <---------bZIP60(2)
                                                                         <---------ANAC58
                                                                         <---------ANAC46
                                                                         <---------ANAC58
                                                                      --------->bZIP60(1)
                                                                      <---------bZIP60(1)
                    *TSS                                        --------->DOF5.7(1)
                   --------->DOF5.7(1)                         <---------AHL25(1)
   --------->MYB52(1) --------->ALFIN1                         --------->AHL25(2)
-AHL20(2)          --------->DAG2       <---------ANAC58       --------->AHL20(2)
--------->DOF2    ---------->DOF2       <---------ANAC46       <---------AHL12(3)
---->TOE2(3) <----------ID1             <---------ANAC58       <---------AHL25(2)--------->YAB1
 
ttaaaagaacgaagaagagacaaaagtgggaacttaaacgatgtcgtgttttgaccaaaaaaaaaaaaaaatgatgtcgtgtcatgataaaacgaagttg  20558000
                                                                                         --------->KAN4(2)
                                                                                        --------->HSFB2a(1)
                                    --------->ANAC46                                    <---------HSFC1(2)
                                ---------->DOF2                                         <---------KAN1
                             ----------->GT1       --------->RVE1(2)                    --------->HSFC1(2)
                  *TSS       --------->YAB1<---------DEAR3(2)                           <---------KAN4(1)
      <---------TOE2(3)     <<<<<<<<<ARR1<------NtERF2                                  --------->KAN1
      <---------TOE1(3)     <<<<<<<<<ARR2<---------MYB52(1)           <<<<<<<<<TBF1     <---------HSFB2a(1)
   <---------MYB52(1)  <-----------GT1  ------>NtERF2 --------->WOX13(1)    ------>ZmHOX2a(1)
  --------->WOX13(2)<---------WOX13(2)  <-----------HVH21          <<<<<<<<<TBF1        --------->KAN4(1)
  <---------WOX13(2)--------->WOX13(2) --------->DEAR3(1)       <<<<<<<<<TBF1          <---------KAN4(2)
 
ttctcagttaaggttttgtttgtaatttacaatcgtaaaacgccgtcgtttcagtatcaatctcttcttcttcttcttcctctcaaaccgaatgttcttc  20558100
                             --------->ZAT14
                             <---------ZAT14
         --------->GLK1(2)   <---------ZAT18
   <-----------HVH21    --------->ZAT18
  <---------DEAR3(2)  <-------MYC2                          <---------At4g35610
  <------MYB83        ------->PIF5                          --------->At4g35610
  <------MYB46(1)     <-------MYC3                         <---------GATA12
 <---------MYB46(3)   ------->MYC3                         --------->GATA12
 <---------DEAR3(1)   <-------PIF5             ----------->GT1  ---------->DOF2                  <--
<---------ORA47(1)    ------->MYC2 <---------ATHB12     <-----------GT1                     --------
 
ttggtcggtcacaatctgttctgcacgagcactgcacaatcacttggagtctgtgaatttcacatctgaaagaaatacaaactcccatagttttcaattt  20558200
               --------->ANAC46
   ------>ZmHOX2a(2)
  --------->GLK1(1)
  <------ZmHOX2a(2)
  <---------GLK1(1)
 <---------ARR14(2)                                 --------->At4g35610
 --------->ARR14(2)                                 <---------At4g35610
 --------->ARR11(3)                            --------->ANAC58                   <---------WOX13(2)
 <---------ARR11(3)                            --------->ANAC58           <----------DOF2
 <---------GATA12                              --------->ANAC46          <---------DOF5.7(1)
 --------->RVE1(2)     <---------RVE1(2)       <---------ANAC55(2)     <---------------AGL15
 --------->GATA12  <----------DOF2             --------->ANAC55(1)     --------------->AGL15
---------GT1 <-----------GT1                   --------->ANAC55(2)    <-----------------AGL1
->WOX13(2)<---------KAN1                 --------->KAN1               <-----------------AG
 
tcacgatctccgaatttcacgactttgatacttggtttctttgcacattcacgtaagctccaattcttccttctcttcttttggcaattgattcacatcg  20558300
                 --------->KAN1
                <---------ARR11(3)
          <---------DOF5.7(2)
         --------->WRKY12
         --------->WRKY45
         --------->WRKY38(1)
         ----------->HVH21                    <---------MYB46(3)
        --------->DOF5.7(2)               <---------YAB1
       <-------GAMYB         <---------ARR14(2)
      <---------ANAC58       <---------ARR11(3)   --------->AHL20(2)
      <---------ANAC46       --------->ARR14(2)----------->GT1
      <---------ANAC58       --------->ARR11(3)<-------GAMYB                     ----------->GT1
 <-----------RAV1(1)         <---------RVE1(2)----------->GT1                  ---------->DOF2   ---
 <---------ZAT6 --------->ARR11(3) <---------ANAC46<---------YAB1       <---------ZAT6         <----
 
aatagtgttgcgttgacgagttcttcgttacagatattgtgtattatggctgttaaaattgaatttgaattgttagtattagcaaagtaatacaaagttt  20558400
<- Previous    Next ->

AGI:  At1g55080.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G29580.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45707.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN78638.1)
Range:  from: 20556678    to: 20557921    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g55090.1   
Description:  carbon-nitrogen hydrolase family protein. similar to unnamed protein product [Vitis vinifera] (GB:CAO69481.1); similar to putative NAD synthetase [Oryza sativa (japonica cultivar-group)] (GB:BAC07390.1); similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ70674.1); contains InterPro domain Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase; (InterPro:IPR003010); contains InterPro domain Glutamine-dependent NAD(+) synthetase, GAT region (InterPro:IPR014445); contains InterPro domain Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); contains InterPro domain NAD+ synthase; (InterPro:IPR003694)
Range:  from: 20558019    to: 20562196    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version