AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                    <------NtERF2
                                                                    ------>NtERF2
                                                                   --------->ANAC58
                                                                   --------->ANAC58
                                                                  --------->SPL7(1)
                                                                 --------->TCP16(2)
            <------ZmHOX2a(1)                                    <---------ATERF1(1)
          <---------TOE2(3)                                     <---------ARR14(2)
      <-------GAMYB                                             --------->ARR11(2)
     ==============HOX2a_HOX2a                                  --------->ARR14(2)
     <---------MYB46(3)                                         <---------ARR11(2)
     ------>ZmHOX2a(2)                                          <---------PCF5
    <------ZmHOX2a(2)                                          <------MYB83
    ===============HOX2a_HOX2a                  --------->DOF5.7(1)--------->ANAC46
   --------->ARR14(2)                       --------->HSFB2a(2)<---------ANAC58
   --------->GATA12                  --------->GLK1(1)         <------MYB46(1)
   <---------ARR14(2)                <---------GLK1(1)        --------->MYB59
   --------->ARR11(2)                --------->RVE1(1)        <------MYB83
   <---------ARR11(2)                --------->CCA1(1)        <------MYB46(1)
------>ZmHOX2a(2)                    <---------RVE1(1)        <---------MYB46(3)
------ZmHOX2a(2)      <---------ANAC58      <---------HSFB2a(2)<---------ANAC58
------->GATA12        <---------AtLEC2--------->ARR11(3)     --------->ALFIN1
--------GATA12        <---------ANAC58<---------ARR11(3)    <<<<<<<<<MYB98
------->ARR14(2)  <---------ANAC58   <---------CCA1(1)      <--------P
--------ARR14(2)  <---------ANAC58  <---------ARR11(3)     <-------GAMYB                 <---------ANAC46
---DOF2   <---------TOE1(3)         --------->ARR11(3)<----------DOF2         <---------ZAT6   -----
 
agatcggatcgttgaggattagcttgcatgaagtctgaagatatcttcaagaagggactttgggttgggtccgccatggtagtgtttttgtgacttacac  20390300
                                                                                  --------->AHL20(3)
                                                                                  <---------AHL12(3)
                                                                                  --------->AHL12(3)
                                                                                  <---------AHL20(3)
                                                                                  <---------AHL25(2)
                                                                                  --------->AHL25(2)
                                                                                  --------->AHL25(3)
                                                                                  <---------AHL12(2)
                                                                                  --------->AHL12(2)
                                                                                 <---------AHL25(3)
                                                                                 <---------AHL25(1)
                                                                                 <---------AHL25(2)
                                                                                 --------->AHL20(2)
                                                                                 --------->YAB1
                                                                                 --------->AHL12(3)
                                                                      <---------AHL20(3)
                                                                      --------->AHL20(3)
                                                                      <---------AHL20(2)
                                                                    <---------AHL20(3)
                                                                    --------->AHL20(3)
                                                                    <---------AHL20(2)
                                                                    <---------AHL12(3)
                                                                    --------->AHL12(3)
                                                                   <---------AHL12(2)
                                                                   --------->AHL12(2)
                                                                  <---------AHL12(1)
                                                                  --------->AHL12(1)
                                                                  <---------AHL20(2)
                                                                  <---------AHL12(2)
                                                                  --------->AHL12(2)
                                                                  --------->AHL12(3)
                                                                  <---------AHL12(3)
                                                                 <---------AHL25(1)
                                                                 <---------AHL25(2)
                                                                 --------->AHL25(2)
                                                                 --------->AHL25(1)
                                                                 <---------AHL20(2)
          --------->AHL25(1)                                     <---------AHL20(3)
          <---------AHL25(1)                                     <---------AHL12(1)
          --------->YAB1                                         --------->AHL12(1)
          <---------AHL25(3)                                     --------->AHL20(1)
          --------->AHL20(2)                                     <---------AHL20(1)
          <---------AHL20(2)                                     --------->AHL20(3)
         <---------YAB5                                          --------->AHL20(2)
        <---------WOX13(2)                                       --------->AHL25(3)
        --------->WOX13(2)                                       <---------AHL25(3)
       --------->YAB1                                            --------->ARR11(3)
      <---------AHL20(2)                                    --------->AHL20(2)   <---------AHL12(3)
      --------->AHL20(2)                                   <---------WOX13(1)    <---------AHL20(3)
    <----------DOF2         <---------ARR11(3)            <---------WOX13(2)     --------->AHL20(3)
    --------->TOE2(3)       --------->GATA12              --------->WOX13(2)   <---------WOX13(2)
   --------->YAB5           <---------GATA12             --------->ATHB12<---------TOE2(3)
 --------->RVE1(2)          --------->ARR11(3)           <---------AHL20(2)   --------->YAB1       -
 --------->GLK1(2)     ----------->GT1                  <---------AHL20(2) --------->YAB1       ----
 --------->ARR11(3)    --------->YAB1                   --------->AHL20(2) --------->TOE2(3)    <---
 <---------ARR11(3)<------ZmHOX2a(1)                    <---------AHL25(1)<---------YAB1    ------>ZmHOX2a(1)
---->ANAC46<---------AHL20(2)                 --------->WOX13(2) <---------ARR11(3)      ---------->ID1
 
cgaaaatctttaattatatggaggaatagtaaatcttgctaagtaatcccattaacttattaattgaatatatttttatgttaataatatttgtcctaaa  20390400
                                                                                                <---
                                                                                               <----
                                                                                               -----
                                                                                              <-----
                                                                                             -------
                                                                                            <-------
                                                                                            --------
                                                                                           <--------
                                                                           <---------ARR11(3)<------
                                                             <---------WOX13(2)           <---------ICU4
                                                             --------->WOX13(2)           <--------HAHB4
                                                           <---------AHL25(3)             --------->ATHB51
                                                           <---------AHL25(2)             --------->YAB5
                                                           <---------AHL25(1)             -------->ATHB1
                                                           <---------AHL12(3)            --------->AHL12(1)
                                                           --------->AHL12(3)            <---------YAB1
                                                           --------->AHL20(2)            --------->AHL25(3)
                                                           <---------AHL20(2)            <---------AHL12(1)
                                                           --------->AHL25(1)       --------->YAB1
                     --------->YAB1                        --------->AHL12(1)     --------->WOX13(2)
      <---------ARR11(3)                                   <---------AHL12(1)     <---------WOX13(2)
      --------->ARR11(3)                      <---------ARR11(3)           --------->ARR11(3)<------
      --------->RVE1(2)      --------->AHL20(2)            --------->AHL25(3)   <---------AHL20(2) <
     <---------CCA1(2)       <---------AHL25(3)           --------->AHL20(2)    --------->AHL20(2) <
 ----------->GT1     <---------ICU4           <---------RVE1(2)        <---------ANAC58  --------->ICU4
--------->DAG2      --------->ICU4            --------->ARR11(3)       <---------ANAC58  <---------YAB5
--------->DOF2      <---------ATHB12 --------->YAB1       --------->AHL25(3) ------>ZmHOX2a(2)------
----->ANAC46        <---------YAB5   --------->YAB5      --------->AHL12(2)<---------GATA12---------
-------ID1        --------->YAB1    --------->ICU4   --------->ANAC55(2)   <---------RVE1(2)<-------
 
cgaaaagtatatctatttctctaatcatcaaataaaacaatgagtataagatacttacatatttaatttgtttttcttgatcttaaattagaattattaa  20390500
                                                     <---------AHL20(2)
   <----------DOF2                                   --------->AHL12(3)
------WOX13(1)                                       --------->AHL20(3)
-----WOX13(2)                                        --------->AHL25(1)
---->WOX13(2)                                        --------->AHL20(2)
----AHL20(2)                                        <-----------------AGL3
-->AHL20(2)                                        <---------KAN1
--YAB1                                      <-------TEIL
->AHL12(2)                                 --------->ARR14(1)                  --------->TOE1(2)
-AHL12(2)                                  --------->CCA1(2)                 --------------->AtSPL3
---AHL20(2)                               <---------ARR14(2)                 <---------------AtSPL3
---AHL25(1)          --------->AtLEC2     <---------GLK1(2)--------------->AtSPL8                <--
---------GLK1(2)     --------->ANAC58     <---------GATA12 <---------------AtSPL8               <---
---------RVE1(2)     --------->ANAC58     --------->ARR11(1)                 <---------------AtSPL8
--->ATHB12       <---------ARR11(3)       --------->ARR14(2)                ---------->DOF2   <-----
>AHL12(2)        --------->ARR11(3)      --------->KAN1<---------AHL20(3) <---------YAB1    <-------
--AHL12(2)      --------->YAB1          --------->DOF5.7(1)<---------------AtSPL3        <---------RVE1(2)
 
ttgattcttttagtttcaaatatcatgcaaatatagatggcaaaagattcgagcatataaatatggtacttcaaattgtgaaagtacgatttgattttct  20390600
                 <---------ARR11(3)                                                             ----
                 <---------RVE1(2)                                                             -----
                --------->YAB1                         <---------KAN1                          -----
              <---------TOE2(2)                       <-----------ARR10                       ------
           --------->ANAC55(2)                <---------ANAC46                            ----------
      <---------------AtSPL3                  <---------ANAC58                           --------->AHL20(2)
    <-----------RAV1(1)---------->DOF2        <---------ANAC58                           --------->RVE1(2)
  <----------DOF2--------->ARR11(3)   --------->YAB5  --------->GLK1(2)             ------------>CBF
--------DOF2--------->TOE1(2)        <---------YAB1  <---------GLK1(2)             --------->ANAC58
------DOF5.7(1)<---------YAB1      <---------KAN1--------->ZAT14                   --------->ANAC58
------GT1 ------->TEIL<---------AHL20(2)<---------YAB1--------->ARR11(3)           --------->ANAC46
----GT1 <---------SPL7(1)       <------ZmHOX2a(1)<---------ZAT14               <---------ZAT6 ------
 
cttttctttgttgtacgtatgatattaaaagtagaggaatatgattcttgagtgtagaatcttgccttctaccatggttcaagtgtaagcaatataaaaa  20390700
                                                                                         <---------At4g35610
                                                                                      ---------->DOF2
                                                   <---------WOX13(2)             --------->At4g35610
                                                   --------->WOX13(2)           <---------ICU4
                                                 <---------AHL20(2)            <---------YAB5
                                             <----------DOF2                 --------->YAB1
  --------->GATA12                          <---------DOF5.7(1)             <------ZmHOX2a(2)
----->DOF5.7(1)                           <---------ARR11(3)               --------->ARR11(2)
---->DOF5.7(1)            *TSS        --------->ANAC46                     --------->GATA12
---->DAG2       <---------ANAC58      --------->ANAC58                     <---------RVE1(2)
--->DOF5.7(1)   <---------ANAC58      --------->ANAC58<-----------GT1      <---------ARR11(2)
->TBP<---------ANAC46    <----------DOF2  --------->ARR11(3)               <---------GATA12
---->DOF2     <-----------GT1<---------RVE1(2)   <---------AHL25(1)      <---------MYB46(3)    -----
 
agggagatgtgtgtttatttcttcccaactttgatactcacaagacatctttttaattcactcccttgcaaaatggtggatcatcatctcaaagctgatc  20390800
                                                                 --------->At4g35610
                                                                 <------NtERF2
                                                                <---------DEAR3(2)
                              <------MYB46(1)                   <---------ATERF1(1)
                              <------MYB83                      ------>NtERF2
                             --------->MYB59                   --------->ATERF1(2)
                          --------->WOX13(2)                   <---------ATERF1(2)
           <--------P     <---------WOX13(2)                   <---------DEAR3(1)
      <---------LBD16  --------->WRKY18(1)                     <---------RAP2.6(2)
     <---------ANAC46 <--------ZAP1                  ---------->DOF2
     <---------ANAC58<---------DEAR3(2)     --------->ANAC58   --------->RAP2.6(2)
     <---------ANAC58<------MYB83           --------->ANAC58  --------->RAP2.6(3) ----------->GT1
->ZmHOX2a(2)         <------MYB46(1)  <-----------HVH21--------->DOF5.7(1)  <---------KAN1----------
 
gtgtagttgctcgggtagagaagtcggtcaatttggttataggtcataggcaaacacaaaggcaggccggctcaagggagtatgaaggtgaatcaaagca  20390900
                 ------>ZmHOX2a(2)
                 <-----------------AGL1
               --------->RVE1(2)
               <---------ARR11(3)
               --------->GATA12     <--------ATHB1
               <---------GATA12 --------->ICU4
               --------->ARR11(3)   -------->HAHB4
               --------->ARR11(2)   --------->YAB5
               --------->ARR14(2)   --------->ATHB12                                     <----------
               <---------ARR11(2)  <---------YAB5                                        ===========
               <---------ARR14(2)  <---------YAB1                                       <---------WOX13(1)
  --------->ANAC58            --------->YAB1                 --------->ANAC58          >>>>>>>>>ARR1
  --------->ANAC46<---------------AGL15                      --------->ANAC58          >>>>>>>>>ARR2
  --------->ANAC58--------------->AGL15                    ---------->DOF2            --------->YAB1
 <-------TEIL --------->HSFB2a(1)  --------->ICU4     <------MYB83                    --------->YAB5
 <---------ZAT14 <-----------------AGL3               <------MYB46(1)                 --------->ATHB12
 --------->ZAT18 ----------------->AGL3               ----------->GT1                <---------YAB1
 <---------ZAT18 ----------------->AGL2              --------->MYB59               --------->YAB1  <
 --------->ZAT14<------ZmHOX2a(2)--------->YAB1  --------->DOF5.7(1)             ------>MYB83 <-----
>DOF2         <---------HSFB2a(1)<---------ICU4---------->DOF2                   ------>MYB46(1)   -
 
gaagtacacaactaagaagatcccaaaatggaagcataatgattcagagagaaagataggtcaaaagcaaaacaatgaaacaccaactatgattgtcgct  20391000
                                                                              -------->HAHB4
                                                                              <---------AHL20(2)
                                                                              --------->ATHB51
                                                                              --------->ATHB12
                                                                              -------->ATHB1
                                                                              <---------ICU4
                                                                             --------->ICU4
                                                                             <---------ATHB51
                                                                             <---------YAB1
                                                                             <---------YAB5
                                                                            <---------AHL12(2)
                                                                            --------->AHL12(2)
                                                                            <---------WOX13(2)
                                                                            --------->WOX13(2)
                                                                           <---------AHL25(3)
                                                                          --------->AHL12(3)
                                                                          <---------AHL12(3)
                                                                          <---------AHL20(2)
                                                                          --------->AHL20(3)
                                                                          <---------AHL20(1)
                                                                          <---------AHL12(1)
                                                                          --------->AHL20(1)
                                                                          --------->AHL12(1)
                                                                          --------->AHL20(2)
                                                                          --------->AHL25(3)
                                                                          <---------AHL25(2)
                                                                          --------->AHL25(2)
                                                                          --------->AHL25(1)
                                                                          <---------AHL25(1)
                                                                        --------->AHL12(2)
                                                                        <---------AHL12(2)
                                                                        <---------WOX13(2)
                                                                        --------->WOX13(2)
                                                                       --------->YAB5
                                                                       <--------HAHB4
                                                                       --------->YAB1
                                                                       <---------ICU4
                                                                      --------->AHL20(2)
                        <---------TGA1a                               --------->AHL25(3)
                        --------->TGA1a                               --------->ICU4
               --------->GATA12  <---------ALFIN1           --------->RAP2.6(2)
               <---------GATA12<----------DOF2              ----------->RAV1(1)
         --------->ANAC58<-------MYC3                    --------->ANAC58 <---------AHL25(3)
       <-----------RAV1(2)--------->ALFIN1               --------->ANAC58 <---------AHL20(3)
     <-----------HVH21  ==================bZIP_DOF       --------->ANAC46--------->AHL25(3)
   <---------MYB46(3)   ==================bZIP_DOF <---------ZAT2     <---------AHL12(1)       -----
-RAV1(1) --------->ANAC58------->MYC3              --------->ZAT2   --------->YAB1             <----
===================RAV  <---------O2               <---------At4g35610<---------KAN1       ---------
---------MYB46(3)       <---------PIF3(3)      ------>ZmHOX2a(1)---------->DOF2          --------->ZAT2
----ANAC46 ----------------->AGL1--------->REM1(1) --------->At4g35610--------->AHL12(1) <---------ZAT2
-------->MYB55(2)       --------->O2     --------->KAN1<---------ALFIN1--------->ATHB51 --------->GLK1(2)
 
ggtggatgggtcaggccaaatcgagccatgtgggcttcacctccaaattcctcgagctccaagccacaaaagaataattaattattgagagaagctggtg  20391100
                    <---------AHL25(3)
                    <---------AHL20(2)
                   <---------AHL12(3)
                   --------->AHL25(1)
                   --------->AHL20(2)
                   <---------AHL20(2)
                   --------->AHL25(3)
                   <---------AHL25(1)
------>GT1         <---------AHL25(3)
-----MYB46(3)    --------->WOX13(2)                                                    --------->AHL20(2)
>ALFIN1          <---------WOX13(2)            <-----------RAV1(1)                 <-------TEIL
 
gtaacatatataagaactcaaattaaatgttcaagttgggaagtagacaactgttgagcgagaacaaggccagtcgtttcaaaacatccattaaaaactc  20391200
<- Previous    Next ->

AGI:  At1g54575.1   
Description:  unknown protein
Range:  from: 20390727    to: 20391377    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version