AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                             <------
  <---------GATA12                                                   <-------TEIL <---------ALFIN1
 --------->GLK1(1)                                                  <-----------GT1      <---------TOE2(3)
 <---------GLK1(1)        ----------->GT1                        --------->ANAC58 ------->GAMYB  <--
------WOX13(1)            --------->YAB5                         ----------->GT1  ----------->RAV1(1)
--->ATHB12               ----------->GT1                         --------->ANAC58--------->MYB46(3)
---YAB5          <----------DOF2  <----------ID1     <------ZmHOX2a(1)          -------->P<---------REM1(1)
 
ttggaaatcgaacaccaagtctttagaaacgataaaaaaaacaaacaaaaaaaacaggaaatgaaaacaagttacattttagcaaccacattgatgtaac  20151300
                                                 --------->ARR14(2)
                                             <-----------GT1
                                           <----------DOF2
                                          <---------ANAC58
                                          <---------ANAC58
                                     --------->CCA1(2)            <---------ANAC58
                                    --------->ARR11(3)            <---------ANAC58
                                    <---------ARR11(2)            --------------------->WRI1
  ----------->HVH21<---------ANAC58 --------->ARR14(2)            <---------ANAC46
<---------ANAC46 <---------YAB1     <---------ARR14(2)          ------>NtERF2       <---------At4g35610
<---------ANAC55(2)<---------ANAC58 <---------RVE1(2)      --------->ZAT18          --------->At4g35610
-----GT1  <---------WRKY38(1)       --------->ARR11(2)     <---------ZAT14<---------GLK1(2)   ------
-------MYB52(1)--------->KAN1     ----------->ARR10  ------>ZmHOX2a(1)   --------->YAB5       <-----
 
gttatgtgaagggtcgactcatgcttgatgttatagtcagatatggctttactatcctcgagtaccctgccttgaaagattagcctctgctgttctactg  20151400
                                                                     <------MYB46(1)               -
                                                                     <------MYB83                  <
                                                                     <---------MYB46(3)       ------
                                                                    <---------AtMYB61         ------
                                                                   <--------P                 <-----
                  <---------ANAC58                               --------->ALFIN1             <-----
                  <---------ANAC58                             <------MYB83                <--------
                 --------->ATHB12                              <------MYB46(1)             ---------
      <----------DOF2                                         <---------TOE2(2)   --------->DOF5.7(1)
     <---------DOF5.7(1)                                   --------->TOE2(1)  --------->ANAC46<-----
    <---------DOF5.7(1)                            <---------DOF5.7(1)       <---------LBD16 -------
--->HSFB2a(2)   <---------YAB1            <-----------HVH21--------->TOE1(1) --------->LBD16 -------
----HSFB2a(2)------>ZmHOX2a(1)           <---------bZIP60(1)  <---------TOE1(2)--------->LBD16<-----
 
gaatgccttctttctcctcatgcttggccttgagttctctaatggtgtcagaccccttaacctcgtaggtgttggttctccccgtaagagtcttaataaa  20151500
                                                                     ------->TEIL
                                                                     --------->ARR11(3)
                                                                     --------->ARR11(2)
                                                                     <---------RVE1(2)
     <---------ICU4                                                  <---------AGP1
    --------->ICU4                                                   --------->GATA12
    <---------YAB5                                                   <---------GATA12
    <---------YAB1                                                   <---------ARR11(2)
  <---------ICU4                                  <---------LBD16    <---------ARR14(2)
  --------->YAB1   <---------LBD16        --------->ANAC58           <---------ARR11(3)
 <---------YAB1  --------->GLK1(2)        --------->ANAC58           --------->ARR14(2)
 --------->ICU4  <---------ARR11(1)     --------->MYB46(3)  --------->GLK1(1)
 <---------YAB5  --------->RVE1(2)  --------->CCA1(2)     <------NtERF2
-------->YAB1    ------->TEIL       <------ZmHOX2a(2)     <---------At4g35610
---------ICU4    --------->ARR11(2)<---------ARR14(2)     --------->At4g35610
--->AHL12(3)     <---------ARR11(2)<---------GATA12      <---------DEAR3(2)
--->AHL20(3)     --------->ARR14(2)--------->ARR11(3)   <---------DEAR3(1)
----AHL12(2)     <---------ARR14(2)--------->RVE1(2)   --------->RAP2.6(3)
----AHL12(3)    <---------CCA1(2)  --------->GATA12--------->ANAC55(2)
-WOX13(2)       <---------ARR14(1) --------->ARR14(2) <---------ARR14(2)
>WOX13(2)       <XXXXXXXXXXXXXXXXXXXXMIR826--------->MYB46(3)       <---------CCA1(2)
----AHL25(1)   --------->LBD16     --------->ARR11(2) --------->ARR11(2)             --------->ALFIN1
-->YAB1 ------>ZmHOX2a(2)          <---------ARR11(2) --------->ARR14(2)   <---------AtMYB61<-------
-->AHL20(2)   --------->ANAC46     --------->AGP1<-----------GT1<---------AtLEC2     <-----------RAV1(1)
----AHL20(3)  --------->ANAC55(2) --------->At4g35610 <-----------HVH21------>ZmHOX2a(2)    --------
 
aatcatcatgatcgcacccgtatctggagttggactcagatccacaaccaattcacgggtcggctctccatggatcttgaggtcgatggtgttggagcta  20151600
                    <----------DOF2
                   <---------DOF5.7(1)
                  ------>ZmHOX2a(1)                                 <-----------GT1              <--
             --------->KAN1                  --------->KAN1        <---------CCA1(2)            <---
--At4g35610<---------DAG2               --------->YAB1          <----------DOF2                <----
->At4g35610<----------DOF2          --------->KAN1  --------->RVE1(2)                   ------>ZmHOX2a(1)
 
tcttcaacctctagctttatcctctttccctccaacgtcttaatcgaaatatgcatagcaaactcaacttttatctctctctctctctctcctctctgtc  20151700
                                            ------------>CBF
                            <---------AHL12(3)            <---------YAB5
                            <---------AHL25(1)         --------->KAN1
                            --------->AHL25(1)       --------->ANAC55(2)
                            <---------AHL25(3)       <---------ANAC55(2)
                            <---------AHL20(2)      <---------ICU4                      <-------MYC3
                           --------->AHL12(1)    <--------ATHB1                         ------->MYC3
        --------->ANAC46   <---------AHL12(1)    --------->YAB1                        <---------O2
    <-----------GT1        --------->AHL20(2)   <---------ATHB51                    <---------ARR11(2)
-------DOF5.7(1)           --------->AHL25(3)   <---------ATHB12    <-----------GT1 --------->ARR11(2)
-------DOF2        ---------->DOF2        <---------ARR11(2) ---------->ID1<<<<<<<<<<GT-3b       ---
-----DOF5.7(1)<----------DOF2             --------->ARR11(2) <---------MYB52(1)<----------DOF2<-----
 
tttttttatacataccactttgcaaagagatttatttgtcttacagttccaataatacttattcgttgttttgactatttttctttggaaacgtggtctt  20151800
                      <---------ZAT14
             <---------WOX13(1)
            <---------WOX13(2)
            --------->WOX13(2)
            <------------CBF
           --------->ATHB12              <---------DOF5.7(1)
          --------->AHL20(2)      <-----------RAV1(1)        <----------DOF2      <---------DAG2
  ---------->DOF2     --------->ZAT14 ------>NtERF2       <-----------GT1    <-----------GT1
------>YAB5<---------AHL20(2)   ------>MYB46(1)          <-----------GT1   <---------AHL12(1)   <---
-----DOF2 <---------AHL20(2)    ------>MYB83        <----------DOF2  <-----------GT1          ------
 
tgattaaaagctattaattgatcagtgaagaaaccaaatgctgccccttcgatttcttttttatcttttttttttcaaattttcaatttttgtgttcctc  20151900
                                       <---------YAB5
                               <---------bZIP60(1)               <---------WOX13(2)
                               --------->bZIP60(1)         <---------AHL12(1)
                          --------->YAB1                 ------>MYB46(1)                        ----
                          --------->YAB5       --------->KAN1<-----------GT1                    <---
   <---------KAN1         <---------ICU4--------->YAB1 <---------MYB59             --------------->AGL15
------WRKY18(1)          <---------ATHB12     --------->AHL20(2) --------->WOX13(2)<---------------AGL15
>ZmHOX2a(1)         <---------ARR11(3)<---------ARR11(3) ------>MYB83              <----------DOF2--
 
gaccgaatgtagaaggtttacaagttctatcatgacttcataatcttcataaattcgaccaaattttcaatttgaccacaagttttctttatttagtcga  20152000
                                                                                                 ---
                                                                                                <---
                                                                                                <---
                                                                                               <----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                             -------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                            <-------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                           <--------
                                                                                           ---------
                                                                                          --------->AHL12(1)
                                                                                          --------->AHL25(3)
                                                                                          <---------AHL25(1)
                                                                                          <---------AHL20(2)
                                                                                          --------->AHL25(1)
                                                                                          --------->AHL20(2)
                                                                                         --------->AHL25(3)
                                                                                         <---------AHL25(2)
                                                                                         --------->AHL12(2)
         <-------PIF5                                                                    <---------AHL12(2)
         ------->PIF5                                                                    --------->AHL25(2)
     --------->ZAT14             ---------->DOF2                     --------->At5g28300 --------->AHL12(3)
     <---------ZAT14       --------->ANAC58                         ----------->GT1      <---------AHL12(3)
   --------->ANAC46        --------->ANAC58                        --------->ZAT6       --------->TOE2(3)
----->WOX13(2)           --------->MYB52(1)         <---------AHL25(3)                  --------->YAB1
---------CBF            <---------SPL7(1)--------->YAB1           <---------At5g28300 *TSS<---------AHL12(1)
--------->HVH21     ----------->HVH21   <-------TEIL--------->AHL20(2)             ------------>CBF
 
attgacacagcacttgctattccatgacgaacgaaacaaagcattcatatacaaataaaacagagcatttacagtaaaaccaagaacacaatattaatta  20152100
<---------YAB5
------>AHL20(2)
------YAB1
------AHL12(2)
-----AHL12(2)
-->HAHB4
----AHL20(2)
-->ATHB1
----AHL25(3)
--->ATHB51
---HAHB4
--->AHL12(1)
----ICU4
----AHL12(1)
--->YAB1                                                     <----------DOF2
-->AHL25(3)                                            <---------ARR11(2)
---ATHB51                                              --------->ARR14(2)         <---------ANAC46
-->ICU4                                                --------->ARR11(2)     <---------RVE1(2)
---YAB5                                                ------>MYB83<---------ANAC58
---YAB1                                                ------>MYB46(1)        --------->ARR14(2) <--
--AHL12(2)                                             <---------ARR14(2)     <---------GLK1(2)  <--
->WOX13(2)                                            --------->WOX13(1)      <---------ARR14(2) ---
->AHL12(2)                                           --------->AtMYB61      <---------RVE1(2)  -----
--WOX13(2)                                       ------->GAMYB --------->KAN1--------->KAN1   <-----
-ICU4                                           --------->MYB46(3) <---------ANAC58          <------
>YAB1                                  --------->GLK1(2)    <---------DOF5.7(1)--------->GLK1(2)<---
 
ttaaacatggaagacaacaacaacaacaacaacaacaacaacaatctggtaacagaccaatccgctttgttcgtgtttggagattctgtgtttgatggcg  20152200
<- Previous    Next ->

AGI:  At1g53950.1   
Description:  ubiquitin family protein. similar to UBQ3 (POLYUBIQUITIN 3), protein binding [Arabidopsis thaliana] (TAIR:AT5G03240.3); similar to UBQ3 (POLYUBIQUITIN 3), protein binding [Arabidopsis thaliana] (TAIR:AT5G03240.2); similar to UBQ4 (ubiquitin 4), protein binding [Arabidopsis thaliana] (TAIR:AT5G20620.1); similar to ubiquitin [Mytilus edulis] (GB:CAJ32650.1); contains InterPro domain Ubiquitin; (InterPro:IPR000626)
Range:  from: 20150116    to: 20151656    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g53970.1   
Description:  unknown protein
Range:  from: 20152087    to: 20152566    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version