AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
             --------->ALFIN1
            ------->PIF5
            <-------MYC2
            ------->MYC3
            <-------PIF5
            ------->MYC2
            <-------MYC3
           --------->O2
           ===================bZIP_DOF
           --------->ANAC55(2)
           =================================================bZIP_DOF
           ==================================bZIP_DOF
           <---------bZIP60(2)
           <---------TGA1a
           --------->TGA1a
           <---------O2
           <---------ANAC46
           <---------ANAC55(2)
       <-----------HVH21
       <----------------PIF3(2)
      <---------DEAR3(2)
     --------->DEAR3(1)                                                   ----------->HVH21
    <------NtERF2                                                  ------>MYB46(1)
    --------->ATERF1(1)                                          <---------MYB59
   ------>NtERF2                                              <---------WRKY18(1)
  --------->ANAC46                                           --------->WRKY12
--------->TGA1a                                              --------->ETT(2)
--------->ANAC58        --------------->AtSPL8               <---------ETT(2)
<---------TGA1a    ------>ZmHOX2a(1)                         --------->WRKY38(1)
--------->ANAC58   <----------DOF2                        ------>ZmHOX2a(1)                   <-----
--------->ANAC46  <---------DOF5.7(1)           <---------DOF5.7(1)------>MYB83       ------->TEIL
-->ARR10----------->HVH21         <----------DOF2<----------DOF2-------->ZAP1     --------------->AtSPL8
 
ctcacgcgccggtcacgtggtcctttcgctgtacatactttactatgtctgtcttttcttcctgttgaccgaacaatgtgacctccttgtacctccacaa  19855000
                                                                      <---------KAN1
                                                                     --------->RVE1(2)
                                                               <---------ANAC46
                                                              <------NtERF2
                                                              --------->ATERF1(1)
                                                             ------>NtERF2
                                                            --------->DEAR3(1)
                                                            <---------DEAR3(1)
                                                            ----------->HVH21
           <---------ALFIN1                                --------->RAP2.3(1)
           --------->DEAR3(1)                              --------->ATERF1(1)
          <---------MYB55(2)                               <------NtERF2
          --------->MYB46(3)                              <---------DEAR4(2)
        --------->AtMYB61                                 <---------ERF1
        ------->GAMYB                                     <---------RAP2.3(1)
       <---------MYB55(2)                                 <---------ORA47(2)
       --------->MYB46(3)                                 <---------ATERF1(1)
      --------->ANAC58                                    ------>NtERF2
      --------->ANAC58             <---------MYB46(3)    <---------RAP2.3(3)
      -------->P                <------MYB83             <---------ANAC46
   ------>NtERF2                <------MYB46(1)          <---------RAP2.3(2)
   <------NtERF2<---------MYB52(1)<---------AtMYB61      <---------RAP2.6(2)
   --------->LBD16             <---------AtMYB61         <---------DEAR3(1)                    <----
  --------->RAP2.3(2)          <---------MYB46(3)        --------->ATERF1(2)                  ------
  --------->RAP2.6(2)         <---------WOX13(1)        --------->ATERF1(1)          <---------MYB52(1)
  --------->DEAR3(1)     <---------At4g35610            <---------ABI4(1)           <-------GAMYB
  --------->ANAC46      <---------DEAR3(1)      <---------HSFC1(1)   --------->GLK1(2)     ---------
  --------->RRTF1(2)  <-----------HVH21         <---------HSFB2a(2)  <-----------ARR10    <---------
 --------->RAP2.3(1) --------->ANAC46           --------->HSFB2a(2)  <---------GATA12--------->DOF5.7(2)
----GLK1(2)--------->AtMYB61--------->ATHB12<---------CCA1(2)<---------ATERF1(1)   <---------MYB46(3)
 
tctcgccgcaaccaccaccgttctccgtcgctgattggtggtgtctcatctctagaagaggcggcgacggagaatctaagaaatggtcgttatctggtgc  19855100
                                                                      <---------RAP2.3(1)
                                                                      ------>NtERF2
                                                                      <---------RRTF1(1)
                                                                      <---------ERF1
                                                                     <---------O2
                                                                     --------->O2
                                                                     <---------RAP2.3(2)
                                                                     <---------DEAR3(1)
                                                                    <------NtERF2
                                                                   ------>NtERF2
                                                                  --------->DEAR3(1)
                                                                  <---------DEAR3(1)
                                                                 --------->ATERF1(1)
                                                                 --------->RAP2.3(1)
                                                                 <------NtERF2
                                                                <---------RAP2.3(1)
                                                                <---------ERF1
                                                                <---------RAP2.6(1)
                                                                <---------DEAR4(2)
                                                                ------>NtERF2
                                                                <---------ORA47(2)
                                                                <---------RRTF1(1)
                                                                <---------ATERF1(1)
                                                               <---------RAP2.3(2)
                                                               <---------ATERF1(2)
                                                               <---------DEAR3(1)
                                                               <---------ANAC46
                                                               --------->DEAR3(1)
                                                              --------->At4g35610
                                                              <---------At4g35610
                                                              --------->RAP2.3(1)
                                                              --------->DEAR4(2)
                                                              <------NtERF2
                                                              --------->ATERF1(1)
                                                             <---------RAP2.6(1)
                                                             <---------ATERF1(1)
                                                             ------>NtERF2<-------GAMYB
                                                             <---------ERF1
                                                             <---------RAP2.3(1)
                                                             <---------RRTF1(1)
                                                             <---------ORA47(2)
                                                             <---------DEAR4(2)
                                                            <---------RAP2.3(3)
                                                            <---------DREB2C(2)
                                                            --------->DEAR3(1)
                                                            <---------DEAR3(1)
                                                            <---------RRTF1(3)
                                                            <---------RAP2.3(2)
                                                            <---------RAP2.6(2)
                                                           <---------ABI4(1)
                                                           <------NtERF2 <---------MYB46(3)
                                                          <---------RAP2.3(1)
                                                          <---------ATERF1(1)
                                                          ------>NtERF2  <---------DEAR3(2)
                                                         <---------DEAR3(1)
                                                         <---------RAP2.6(2)
                                                         <---------RRTF1(3)
                                                         <---------DREB2C(2)
                                                  <---------RVE1(2)<---------ATERF1(1)
                                                <------MYB46(1)--------->ATERF1(2)
                                                <------MYB83<---------ATERF1(2)        --------->LBD16
                                             <-------GAMYB<---------RRTF1(1)       ------->GAMYB
                                            --------->MYB111(2)<---------RAP2.3(3)--------->MYB46(3)
                                            --------->MYB55(2)--------->DREB2C(1) --------->DEAR3(2)
                                            <---------MYB46(3)<---------ABI4(1)   <------------AtMYB77
                                         <---------MYB46(3)--------->ATERF1(1)   <---------At5g28300
                                        --------->ALFIN1 <---------RAP2.3(3)    <---------DOF5.7(2)
                                        <---------AtMYB61<---------RAP2.3(2)  <---------MYB52(1)
                                        <---------DEAR3(1)<---------ERF1<---------DEAR3(1) ---------
  <---------REM1(1)                   <---------MYB46(3) <---------RRTF1(2)  <-------GAMYB<------ZmHOX2a(1)
--------->YAB1                       --------->ALFIN1 ----------->HVH21<------NtERF2  --------->DEAR3(1)
--NtERF2                             <---------AtMYB61<---------YAB1--------->ATERF1(1)------>NtERF2
>NtERF2--------->YAB1             <---------AtMYB61 <---------ICU4----------->HVH21--------->DEAR3(1)
>At4g35610                   <-------GAMYB <---------AtMYB61<---------RRTF1(2)--------->DOF5.7(2)
--RAV1(1)<---------KAN1     <---------MYB46(3)<--------P--------->RAP2.6(3) <---------MYB46(3)  ----
 
cattgatgaagcatattgtggaaattcaaggtcgttgatggtggtggtggttggattatgacggcggcggcgacggcggtcgttaaccgccgaggaatcc  19855200
                <---------WOX13(2)
              --------->AHL20(3)
              --------->AHL20(2)
              <---------AHL25(1)
              <---------AHL25(3)
              --------->AHL25(1)
              <---------AHL20(3)
              <---------AHL20(2)
             --------->AHL25(3)
             --------->AHL20(2)
            --------->WOX13(2)
          <---------AHL20(2)
          <---------AHL25(3)
          <---------AHL25(1)
          --------->AHL20(2)
          --------->AHL25(1)
          <---------AHL12(3)                                          ---------->DOF2
         <---------AHL12(1)                       --------->TOE2(3) <---------ATHB12
         --------->AHL20(2)                       --------->TOE1(3)--------->RVE1(2)               -
    <---------TOE1(2)                    --------->RVE1(2)--------->ANAC46                         -
  <---------SPL7(1)                      <---------ARR14(2)   ------>NtERF2                        -
 --------->KAN1 --------->WOX13(2)       --------->ARR14(2)   ----------->RAV1(1)           >>>>>>>>
 <---------MYB46(3)                      <---------GATA12 --------->ANAC58               >>>>>>>>>TBF1
<---------YAB5--------->AHL12(3)         --------->GATA12 --------->ANAC55(1)         >>>>>>>>>TBF1-
>GLK1(1) --------->AHL25(3)<-----------GT1     <---------ALFIN1 --------->MYB46(3) >>>>>>>>>TBF1   <
----->LBD16 --------->AHL12(2)      ------>ZmHOX2a(1)     --------->ANAC58      >>>>>>>>>TBF1      -
 
agagtcgttcgatttatttaattcaacattttgcctctcctccaaatcccaaaccctaaacacgccaacaaatcaaagatgaagaagaagaagaagaaga  19855300
   --------->WOX13(2)
   <---------WOX13(2)
-------->ANAC55(1)
-------->ANAC46
-------->ANAC55(2)                                     <---------GLK1(2)
>TBF1                                                --------->DOF5.7(1)
-------->ANAC58                                      <---------YAB5          ---------->ID1
---------ANAC55(2)         --------->YAB5  <----------DOF2               <---------KAN1
-------->ANAC58      -------->P           <---------DOF5.7(1)  <----------DOF2              *TSS
 
agacgtaattgaattttgcagactaacccatgactaaatttctcttcttttgtctaaagattgtttcttttttagaatttgtctctgtttctgagaattc  19855400
                                                                                       <---------AHL25(3)
                                                                                       <---------AHL25(2)
                                                                                       --------->AHL20(2)
                                                                                       <---------AHL12(1)
                                                                               <----------DOF2
                                                                              <---------DOF5.7(1)
                                                                            <---------ARR11(3)
                                                                            --------->ARR11(3)  <---
                                                                        ---------->DOF2<---------AHL20(2)
                                                                       <------ZmHOX2a(1)        <---
                                                                     --------->LBD16   --------->AHL25(2)
                                                                 --------->RVE1(2)     <---------AHL20(3)
               --------->ANAC58                                  --------->ARR14(2)    <---------AHL25(1)
               --------->ANAC58                                  <---------ARR11(2)    --------->AHL12(1)
             <------ZmHOX2a(1)                                   --------->ARR11(2)  --------->AHL12(2)
--------->ANAC58                                                 --------->GLK1(2) <---------AHL20(2)
--------->ANAC58     <XXXXXXXXXXXXXXXXXXXXXMIR831 <------------CBF  <---------LBD16--------->AHL25(3)
------------------------>ANAC81            <---------GATA12      <---------ARR14(2)--------->AHL20(2)
 
aagaagcaaaaacagaggaagcaagaagagagagaagagatagagagatgtggaattgactaaacgagaatccaggaaagctctttttaattttttgttt  19855500
           <-----------------AGL1
           <---------At5g28300
           <-----------------AG
          <-----------GT1
       <---------AHL12(2)
       --------->AHL12(2)            --------->GLK1(2)
      <---------AHL12(1)            <---------GLK1(2)
      --------->AHL12(1)            <---------RVE1(2)
   <------NtERF2            --------->DOF5.7(1)
  ----------->GT1          --------->DOF5.7(1)
  --------->LBD16         ---------->DOF2                                             <------MYB83
  <------NtERF2    ----------->GT1  --------->ARR11(3)                                <------MYB46(1)
 --------->RAP2.6(2)--------->At5g28300         <---------LBD16                      --------->MYB59
<---------LBD16    ------->GAMYB    <---------ARR11(3)                      <------ZmHOX2a(1) ------
------ANAC58    --------->MYB52(1) <---------RVE1(1)                       --------->DOF5.7(1)------
------ANAC58--------->ZAT6--------->DOF5.7(1)--------->ALFIN1    --------->YAB1--------->ALFIN1 ----
 
ctggccggaaaatttacagtaacggtaaaaaaaggaagagattttggggtttggggaagagagggaaatggtaatggaaggagtgtgtttggtcataaaa  19855600
                                                                              <---------TOE1(3)
                                                                              <---------TOE2(3)
                                                                           <---------AHL20(2)
                                                                         --------->AHL12(2)
                                                                       --------->AHL12(3)
                                                                       --------->AHL12(1)
                                                                       <---------AHL12(1)
                                                                       <---------AHL12(3)
                  --------->YAB1                                       <---------AHL20(2)
                  <---------ICU4                                       <---------AHL25(1)
                 <---------YAB5                                       --------->AHL25(3)
                 <---------YAB1                                       --------->AHL20(1)
               --------->YAB1                                         <---------AHL20(1)
            --------->YAB1                                           --------->AHL12(2)
       <---------RVE1(2)                                             <---------AHL12(2)
---->DOF2  <---------YAB5                                           <---------AHL20(2)
--->DOF5.7(1) <---------YAB5         <---------AHL20(2)            --------->AHL20(2)
----->DOF5.7(1)<---------ICU4 <----------DOF2---------->DOF2 <---------AHL20(2)
 
agagctctctgatactcatcatcatcacttgtgcttttatttcatttttaaagtgttttcttattttatattatatattttatggtttttctaaatgaaa  19855700
                                        ----------->HVH21
                                      <---------AtLEC2
                                 --------->AHL12(2)
                                 <---------AHL12(2)
                                --------->AHL20(3)
                                <---------AHL25(3)
                                --------->AHL20(1)
                                <---------AHL20(1)
                                --------->AHL20(2)
                                <---------AHL25(2)
                                --------->AHL25(2)
                                <---------AHL20(3)
                                --------->AHL12(1)
                               <---------AHL12(3)
                               --------->AHL25(1)                                 --------->AHL12(2)
                               <---------AHL25(1)                                 --------->AHL25(1)
                               --------->AHL12(3)                                 <---------AHL12(3)
                               --------->AHL25(3)                                 --------->AHL12(3)
                               <---------AHL12(1)                                <---------AHL20(1)
                               --------->AHL12(1)                                <---------AHL25(2)
                               --------->AHL12(2)                                --------->AHL25(3)
                    <---------YAB5    --------->ANAC55(2)                        <---------ARR11(3)
           ---------->ID1 ----------->GT1                                <---------YAB1         <---
      <----------DOF2<---------ICU4 <-----------GT1                    <<<<<<<<<<<<<<<<<LFY  <------
  --------->DAG2  --------->YAB1<---------AHL12(1)                 <-------TEIL<---------RVE1(2)<---
 ---------->DOF2 <-------TEIL --------->AHL25(3)                  <-----------GT1--------->ARR11(3)
 
aacaaaaagcttttgtccgattcatcatgtggaaatattttacatgacatttcgaattgtattagctatatacattacaatggatatattttggtagagg  19855800
                                                                          <---------YAB1
                                        <------MYB83                    --------->YAB1
                                        <------MYB46(1)    --------->AHL20(3)
                                       <---------AtMYB61   <---------AHL25(1)
                                       --------->MYB59     <---------AHL25(2)                   <---
         --------->RVE1(2)        <---------TOE1(2)        <---------AHL20(3)                  -----
        <---------KAN1            <---------TOE2(3)        <---------AHL12(3)                 ------
<---------ZAT6                 <---------DOF5.7(1)         <---------AHL20(2)           --------->ANAC58
------ARR14(2)                ------>ZmHOX2a(1)            --------->AHL12(3)           --------->ANAC58
---TOE2(3)                  <---------ZAT18   --------->YAB5          <---------TOE2(3)--------->YAB1
------ARR11(2)       <-------TEIL <---------TOE2(2) --------->ZAT6   ---------->DOF2  ---------->DOF2
 
ttactgtaagaatatcaacacatatacatagtcctcttaggtttggttctgactaccactatttttttttgttaaagatgatagaaactataagcactaa  19855900
<- Previous    Next ->

AGI:  At1g53230.1   
Description:  TCP3 (TEOSINTE BRANCHED1, CYCLOIDEA AND PCF TRANSCRIPTION FACTOR 3); transcription factor. similar to TCP4 (TCP FAMILY TRANSCRIPTION FACTOR 4), transcription factor [Arabidopsis thaliana] (TAIR:AT3G15030.2); similar to TCP4 (TCP FAMILY TRANSCRIPTION FACTOR 4), transcription factor [Arabidopsis thaliana] (TAIR:AT3G15030.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39371.1); contains InterPro domain Transcription factor, TCP (InterPro:IPR005333)
Range:  from: 19853456    to: 19855393    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g53233.1   
Description:  other RNA
Range:  from: 19853699    to: 19855795    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version