AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                      <---------ARR11(2)
                                                      --------->ARR14(2)
                                                      <---------ARR14(2)
                                                      --------->ARR11(2)
                                                   <---------TOE1(3)
                                               <----------DOF2                               -------
                               <---------KAN4(1)   <---------TOE2(3)                         -------
                               --------->KAN4(1)   <---------YAB1                            <------
                               --------->KAN1------>MYB46(1)      --------->GLK1(2)          <------
                     <---------ANAC55(1)     ------>MYB83 ------>ZmHOX2a(1)                  -------
                   <-----------GT1         <---------MYB46(2)   <---------AHL12(1)          ------>MYB83
                 --------->WOX13(2)        <---------MYB59<---------At4g35610       --------->YAB1
                 <---------WOX13(2)        <---------MYB111(1)  --------->AHL12(1) <---------YAB1
               <---------AHL20(2)       <-----------GT1   --------->At4g35610 <---------ZAT6------>MYB46(1)
       <<<<<<<<<<MYB80       <---------RVE1(2) <---------DAG2   <---------KAN4(1) --------->RVE1(2)
 
tttgtattttggtttgagttaattacgagttggattgttcttcttacctactttatggttcctctgaataatctattcgtagtcttatcaaaaccaaatc  19051200
                                        --------->YAB1
                                    <---------ANAC46
                                    <---------ANAC58
                                    <---------ANAC58
                               <---------ICU4
                               --------->ATHB51
                               --------->ATHB12
                               -------->HAHB4
                               -------->ATHB1
      <---------ANAC58        <---------YAB1                                  <---------At4g35610
      <---------ANAC58        <---------YAB5                                  --------->At4g35610
 --------->DAG2               <---------ATHB51                    <---------YAB5
--------->DOF5.7(1)          <---------WOX13(2)                   <---------YAB1
---------->DOF2            <---------AHL20(2)                 <---------AHL20(3)
-->GATA12              <----------DOF2 <-------TEIL           --------->AHL20(3)
-->ARR14(2)  ------->TEIL  --------->AHL20(2)          --------->bZIP60(1)  ========================
---GATA12    <---------GATA12--------->AHL12(2)        <---------bZIP60(1)  <------ZmHOX2a(1)      -
---ARR14(2)  --------->GATA12--------->WOX13(2)      --------->YAB5--------->YAB1                  <
-->RVE1(2)   --------->GLK1(2)--------->ICU4   --------->YAB1<---------DOF5.7(1)                   <
 
caaaaaagtacttgtgaatctatttcctttttaattattgcgttcataaatgaaaatgacaccatttttatcatagtgaggagctcaaatttcaaaactt  19051300
                                                                                                 ---
                                                                     <---------ANAC46            <--
                                                                  <---------GLK1(1)              ---
                                                                  --------->GLK1(1)              <--
                                                                  <---------KAN1                 <--
                                                                 <---------ARR14(2)             ----
                                                                 --------->ARR14(2)           ------
                                                                 <---------GATA12             <-----
                                                                 --------->GATA12         <------NtERF2
                                                                 <---------ARR11(2)      ------>NtERF2
                                                                <------NtERF2           --------->DEAR3(1)
                    <---------MYB59                           <---------ANAC46          <---------ALFIN1
              <---------------AtSPL3                         <------NtERF2             <------NtERF2
        <---------GATA12                                    <---------ATERF1(1)       <---------ATERF1(1)
   --------->LBD16 ----------------->AGL1                   ------>NtERF2--------->YAB5--------->ATERF1(1)
 ------>ZmHOX2a(2)------->TEIL                              <---------RAP2.3(1)       ------>NtERF2
========HOX2a_HOX2a<-----------------AGL1                  <---------RAP2.3(3)       --------->ANAC46
-------->GATA12 --------->ZAT18                            <---------RAP2.3(2)      <------NtERF2---
---------RVE1(2)<---------ZAT14               --------->LBD16<---------LBD16        --------->ATERF1(1)
---------GATA12 --------->ZAT14             <---------LBD16<---------DEAR3(1)      <---------ATERF1(1)
 
ttgatccgagacatctaagtgtaccgaaatttgaaacgggttatgtctccggtgtaatttcgacggcggatttcgtcgattacagtcgtcgccaccgtat  19051400
                                                            <------------CBF
                                                  --------->TGA1a
                                                  <---------TGA1a
                                                  --------->bZIP60(1)
------>AHL12(3)                                   --------->O2                     --------->ANAC46
-------AHL20(2)                                   <---------O2                    <---------YAB5
------>AHL20(2)                                   <---------bZIP60(1)     --------->YAB1       -----
-------AHL12(3)                                   <---------bZIP60(2)     <--------ATHB1       -----
-------AHL20(3)                    <---------ANAC58       <---------YAB1  --------->YAB5       -----
----->AHL12(2)       <---------ATHB51          --------->WRKY12          <---------ATHB12      -----
--->ARR14(2)  --------->At4g35610  <---------ANAC58   <---------DEAR3(2) --------->ICU4   <---------SPL7(1)
----ARR14(2)  <---------At4g35610  <---------ANAC46  <---------DEAR3(1)  <---------YAB5 <------NtERF2
------>AHL20(3)      <---------ATHB12          ----------->HVH21     ------------>CBF <---------DEAR3(1)
 
attaatacacatttggaagctcaaataatgggcttcttgcttgaagcccattgacgtcggtactattgtatttgcaatgattttaaacgtcgtcgtacaa  19051500
        <---------ARR11(2)
        <---------ARR14(2)
        --------->ARR14(2)
        --------->ARR11(2)
     --------->YAB1
  --------->WOX13(1)
 --------->AHL12(1)                    --------->HSFC1(2)
 <---------AHL12(1)                    <---------HSFC1(2)    ------>ZmHOX2a(1)  <---------GLK1(1)
 <---------AHL25(3)                --------->LBD16 ------>NtERF2                <---------KAN1
 <---------AHL20(2)         <---------At4g35610   --------->LBD16               --------->GLK1(1)
 --------->AHL20(2)         <---------CCA1(2)     --------->ANAC46  <---------GATA12
---->ANAC58           <---------DOF5.7(1)         ----------->HVH21 --------->GATA12
---->ANAC58           <----------DOF2 <---------ALFIN1  <----------DOF2    --------->RAP2.6(3)    --
---->ANAC46          <---------DOF5.7(1)          <---------ETT(1)  --------->RVE1(2)   <----------DOF2
---->ANAC55(1) ---------->DOF2   <---------LBD16 *TSS<---------ALFIN1     --------->MYB52(1)    ----
 
gtaataaatcagaacccctaaaacccttttcatctctccggacacttcttctcccgacactttcctcttcaaatcccaaacggctatctgactttggaag  19051600
                        <---------TOE2(3)                      --------->MYB46(3)
                        <---------HSFB2a(2)                  --------->ARR11(2)
                     <---------YAB1                      <---------------------WRI1
                    <---------AHL25(2)          <---------ARR14(2)
                    --------->AHL20(3)          --------->ARR14(2)
             ----------->GT1                    <-----------ARR10
      <-------TEIL  --------->AHL25(2)          --------->GLK1(2)                    --------->YAB1
     --------->GLK1(2)  <---------YAB1          <---------GATA12                   ------>MYB46(1)
   --------->KAN1   <---------AHL20(3)          --------->RVE1(2)                 --------->WOX13(1)
------->DOF5.7(1)  <---------KAN1              <---------GLK1(2)   --------->AtMYB61<---------ATHB12
------>DOF2 --------->ALFIN1      <----------DOF2     <---------ZAT6---------->DOF2------>MYB83  ---
 
aaagagagattcagagtggagaatattatggaaggaactttagatgaagagaatctagtcttcgaaaccaccaaaggtatcaaaccaatcaagagtttcg  19051700
                                     --------->YAB5
                                     --------->ZAT6
                                    <---------YAB1                                            ======
                              <---------ANAC46    --------->ANAC46   --------->ZAT2     --------->ARR11(2)
                    --------->ARR11(3)            --------->ANAC58   --------->At4g35610<---------ARR14(2)
                 --------->DAG2  <---------ARR11(2)  <-----------GT1 <---------At4g35610--------->ARR14(2)
             --------->YAB5  <------NtERF2   <---------ARR11(2)      <---------ZAT2     <---------GLK1(2)
             --------->YAB1 --------->LBD16 --------->At5g28300  --------->GLK1(2) --------->ARR11(2)
            <---------YAB5 <---------DEAR3(1)--------->ARR11(2) <---------GATA12   <---------ARR11(2)
           <---------WOX13(1)------>NtERF2  <-------GAMYB --------->At4g35610    <---------MYB46(3)
        <---------KAN1    <---------LBD16  ----------->GT1----------->RAV1(2) ======================
<---------bZIP60(2) <---------ARR11(3)    <---------TOE2(3)     --------->GATA12<---------AtMYB61 <-
-------->HVH21  ---------->DOF2<----------DOF2    --------->ANAC58<-------TEIL<----------DOF2 ------
 
atgacatggggatgaatgataaagttcttcgcggcgtttatgactacggttacaagaaaccatctgagattcagcagagagctttggttccgattctcaa  19051800
       --------->TGA2(2)
      <-----------HVH21
      <-----------TGA1
     --------->bZIP60(1)                                                                       -----
     <---------TGA2(1)                                                                         <----
     --------->TGA2(1)                                                                --------->HSFB2a(2)
     --------->ANAC55(2)                                                              <---------HSFB2a(2)
     --------->O2                                                                   ------>ZmHOX2a(1)
     <---------O2                                                               --------->RVE1(2)
     --------->TGA1a                                                            <---------ARR14(2)
     --------->ANAC58                                                           --------->ARR11(2)
     <---------TGA1a             ----------->GT1                                <---------ARR11(2)
     <---------bZIP60(1)        <---------ZAT6                                  --------->ARR14(2)
     --------->bZIP60(2)     <---------ARR11(2)                                <---------GLK1(1)
     --------->ANAC58        --------->ARR11(2)                                <---------CCA1(2)
    <-----------STF1        <---------MYB52(1)   <---------WOX13(1)            --------->GLK1(1)
===============bZIP_DOF    --------->LBD16    <---------YAB1            --------->TOE2(3) <---------
===============bZIP_DOF  ----------------->AGL1--------->YAB5        --------->ARR14(2)  ---------->DOF2
-----ZmHOX2a(1)          <-----------------AGL1--------->ATHB12      <---------ARR14(2)--------->LBD16
---->DOF2      <-----------RAV1(2)       --------->TOE2(3)   <---------MYB52(1)--------->KAN1 <-----
 
aggacgagacgtcatagctcaggctcagtccggtactggtaaaacctctatgattgctatctccgtttgccaaatcgtcaacatatcctccagaaagtac  19051900
                                                                    <---------AHL12(1)
                                                                    --------->AHL20(2)
                                                          <---------ZAT18
                                                 --------------->AGL15
                                                 <---------------AGL15
                                                ----------------->AG<---------AHL20(2)
                                                ----------------->AGL3
                                                <-----------------AGL1             --------->ATHB12
                                                <-----------------AGL3             --------->YAB5 <-
                                                <-----------------AGL2            <---------YAB1 <--
                                                ----------------->AGL1            --------->ICU4 <--
                                             --------->GLK1(1)      <---------AHL25(3)       ------>ZmHOX2a(2)
                                             <---------GLK1(1)     <---------AHL12(2)      <--------
                                            <---------GATA12       --------->AHL12(3)      ---------
                                            --------->GATA12       <---------AHL12(3)      <--------
                                            <---------GLK1(2)      --------->AHL12(2)     --------->YAB1
                                     <---------DOF5.7(1)  --------->ZAT18       <---------ANAC55(2)
           --------->LBD16          <---------DOF5.7(1)<---------TOE2(3)        --------->ANAC55(2)
         ----------->RAV1(2)        <---------DAG2 --------->WOX13(2)         <-----------GT1=======
---->ANAC55(2)                      <----------DOF2<---------WOX13(2)      <---------ICU4<---------YAB5
-----ANAC55(2)                     <---------DOF5.7(1) --------->MYB59  --------->YAB1  <---------TOE2(3)
------AtSPL3                   <-----------GT1  <-----------------AG--------->AHL12(1) --------->YAB1
--TEIL   <---------LBD16    --------->YAB1  --------->ARR14(2)    --------->AHL12(2) <---------YAB1
 
gtctctgttttcccctgagattgaaaacaaatagtaaccctttttcagatttccaatttaggtcactaaaatttatcagaattacatgattaatgatctt  19052000
    <---------WOX13(2)
    --------->WOX13(2)                                                  ------>ZmHOX2a(2)
  <---------YAB1                                                      <---------RVE1(2)         <---
---------DOF2                                                         --------->ARR11(3)        ----
-------ANAC58                                                         <---------ARR11(3)        <---
-------ANAC58                                                        --------->YAB1<---------WOX13(2)
-RVE1(2)            <---------ANAC55(2)                             <---------YAB5 --------->WOX13(2)
>ARR11(3)      <------ZmHOX2a(1)                    ----------->GT1<---------WOX13(2)           ----
-ARR11(3)    <---------TOE2(3)              --------->RVE1(2)      <---------TOE2(3)--------->ICU4
======================HOX2a_HOX2a   --------->WOX13(2)             --------->WOX13(2)      <-------TEIL
 
gctttgtaattgagttgaggaacacttatctgtttctccaatttgctaatctacttggtaatacatagttaatgatcttgctctgtaattaagatgcaga  19052100
<- Previous    Next ->

AGI:  At1g51370.1   
Description:  F-box family protein. Identical to F-box/FBD/LRR-repeat protein At1g51370 [Arabidopsis Thaliana] (GB:Q6DBN6;GB:Q3ECS4); similar to F-box family protein (FBL13) [Arabidopsis thaliana] (TAIR:AT5G53840.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN74740.1); contains InterPro domain Leucine-rich repeat 2 (InterPro:IPR013101); contains InterPro domain FBD (InterPro:IPR013596); contains InterPro domain Cyclin-like F-box (InterPro:IPR001810); contains InterPro domain FBD-like (InterPro:IPR006566)
Range:  from: 19048880    to: 19051121    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g51380.1   
Description:  eukaryotic translation initiation factor 4A, putative / eIF-4A, putative. Identical to DEAD-box ATP-dependent RNA helicase 34 (RH34) [Arabidopsis Thaliana] (GB:Q9C8J1;GB:Q9SYE0); similar to eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative [Arabidopsis thaliana] (TAIR:AT3G19760.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO48730.1); contains InterPro domain RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014); contains InterPro domain Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); contains InterPro domain DEAD-like helicase, N-terminal (InterPro:
Range:  from: 19051550    to: 19053830    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version