AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                          ------>ZmHOX2a(2)
                                          <---------DOF5.7(1)                                      <
                                         <---------RVE1(1)                                        <-
                                        --------->AGP1  <---------GATA12                          --
                                        --------->GATA12<---------ARR14(2)                       ---
                                        <---------RVE1(2)                                    <------
                            <---------DOF5.7(1)        --------->KAN1                     --------->GATA12
                            <----------DOF2<----------DOF2                                <---------RVE1(2)
                           <---------DOF5.7(1)      <---------ARR11(3)                    <---------GATA12
                      ---------->ID1    --------->ARR11(3)                                --------->ARR11(3)
                  <----------DOF2       <---------ARR11(3)  --------->LBD16          --------->TOE2(3)
            --------->PCF2 <---------DAG2<------ZmHOX2a(2)<---------LBD16          <-------TEIL <---
--------->LBD16<---------ALFIN1         <---------GATA12--------->ARR14(2)   <-------TEIL <---------ARR11(3)
 
taccgcaaaatttggctcccactttgtctcccttttgttttgagatctttttcaagataaatccggtctatgtagtcacatacacatacattagatttta  16793300
                                                                               --------->KAN1
                                                                               <-----------GT1
                                                                           <---------YAB1
                                                                          <---------AHL25(2)
                                                                          <---------AHL25(1)
                                                                          <---------AHL25(3)
                                                                          --------->AHL25(1)
                                                                          <---------AHL20(3)
                                                                          <---------AHL20(2)
                                                                          --------->AHL20(2)
                                                                          --------->AHL12(3)
                                                                          --------->AHL20(3)
                                                                         --------->YAB1
                                                                     --------->AHL20(2)
                                                                     --------->AHL25(3)
                                                                     <---------AHL20(2)
                                                                     <---------YAB1
                                                                     <---------AHL20(3)
                                                                     --------->AHL20(3)
                                                                    <---------AHL12(2)
                                                                    --------->AHL12(2)
                                                                  --------->ARR11(3)
                                                                  --------->AHL25(1)
                                                                  <---------AHL20(2)
                                                                  --------->AHL20(3)
                                                                  --------->AHL20(2)
                                                                  <---------AHL20(1)
                                                                  <---------ARR11(3)
                                                                  --------->AHL20(1)
                                                                  <---------AHL20(3)
                                                                  <---------AHL25(3)
                                                                  <---------AHL25(1)               <
                                             --------->YAB1       --------->AHL12(1)          ------
                                           <---------WOX13(2)     <---------AHL12(1)          <-----
                                         <---------AHL25(3)       --------->AHL25(3)          <-----
                                       <---------------AGL15      --------->AHL25(2)          <-----
                                       --------->TOE2(3)          <---------AHL25(2)         <------ZmHOX2a(1)
         --------->At4g35610           --------------->AGL15     --------->AHL12(3)       <------NtERF2
---------YAB1          <---------TOE2(3) --------->AHL20(2)      <---------AHL12(1)      --------->LBD16
--------ARR11(3)       --------->DOF5.7(1) --------->WOX13(2)    <---------AHL12(3)     <------NtERF2
------->ARR11(3)     ---------->DOF2  <---------ANAC55(2)        --------->AHL20(2)     <---------ANAC46
------>YAB1       --------->YAB1 --------->YAB5                  <---------AHL25(1) <-----------HVH21
---AHL20(2)       --------->YAB5--------->ICU4          --------->KAN1  <---------YAB1 <---------LBD16
------YAB1       <---------YAB1 <---------YAB1    <---------KAN1 --------->AHL12(1)--------->ANAC46-
 
tgatcatatataagctgtatatgataaaggttgtcacgattacataaattagaatttgaaaattctaaatatattattaaaattactcgtcgcggaggat  16793400
                                                                                   <---------AHL20(1)
                                                                                <---------AHL25(3)
                                                                                <---------AHL20(3)
                                                                                <---------AHL12(3)
                                                                               <---------AHL25(1)
                                                                               --------->AHL25(1)
                                                                               <---------AHL20(2)
                                                                               --------->AHL20(2)
                                                                               <---------AHL25(3)
                                  --------->At5g28300                          <---------AHL12(1)
                                 --------->LBD16        <---------ANAC58       --------->AHL12(1)
                                 ----------->GT1        <---------ANAC46      <---------YAB1
                                --------->ATERF1(2)     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                <---------ATERF1(2)     <---------ANAC55(2)  --------->AHL12(2)
    >>>>>>>>>MYB98    <---------AHL12(2)                --------->ANAC55(2)  --------->WOX13(2)
   <-----------GT1   <---------AHL25(2)                 <---------ANAC58     <---------WOX13(2)
  <-----------GT1    <---------AHL20(3)                 <---------ANAC55(1) --------->YAB5
 --------->AHL20(2)  --------->AHL12(1)              <---------MYB52(1)    --------->AHL25(3)
---------WOX13(2)    <---------AHL12(1)            --------->ANAC55(2)     <---------AHL20(2)
--->ARR14(2)         --------->AHL25(2)            --------->ANAC55(1)     <---------AHL25(1)      x
----ARR11(2) <---------DAG2    --------->RAP2.6(3) --------->ANAC46        --------->AHL20(2)  <----
----ARR14(2) <----------DOF2  --------->MYB52(1)   <---------ANAC55(2)     <---------YAB1    <------
----GATA12<-----------GT1<-----------GT1   --------->DOF5.7(1)             --------->AHL25(1)-------
-------->WOX13(2)    --------->AHL20(3)    ---------->DOF2  --------->AHL25(3)--------->ICU4--------
 
tcaatttaacatattacttttcaaaattttacatgccggtaaaaaaaaaagaatacgttacgtattatttgaattcatataattaatatgtttttcgtta  16793500
                                                                      <---------YAB1
                                                                    -------->HAHB4
                                                                    <---------ICU4
                                                                    --------->YAB1
        xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                       --------->ICU4
      --------->ARR11(2)                                           <---------ATHB51
      --------->ARR14(2)                                          <---------AHL12(2)
      <---------ARR14(2)                                          --------->WOX13(2)
      <---------ARR11(2)             --------->RVE1(2)            <---------WOX13(2)
     <------ZmHOX2a(1)    <---------WOX13(2)                     <---------ICU4  --------->CCA1(2)
   <---------TOE2(3)     --------->ATHB12                        --------->YAB1 <---------ARR11(3)
  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)                          --------->AHL25(1)
xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)  --------->GATA12           <---------AHL20(2)
-----DOF5.7(2)   --------->ATHB12    <---------GATA12   --------->ARR11(3)      --------->ARR11(3)
---MYB52(1)    <-------GAMYB    ----------->GT1         <---------ARR11(3) <---------ATHB12
-->DOF5.7(2)<---------ANAC58 --------->ATHB12    <---------KAN1 --------->AHL20(2)
->TOE2(3)   <---------ANAC58<---------YAB5     <---------GLK1(2)--------->AHL25(3)      <---------RVE1(2)
 
gcgatgaaggatagggggtgttattggtttattgattgtaaatctatatagaatttgaacatctctattaattatgaaatcaagatatatggattttgaa  16793600
                                                                                      <---------GATA12
                                                                              --------->GATA12
                                                                              <---------RVE1(2)
                                                                              <---------ARR14(2)
                                                                              --------->ARR11(2)
                                                                              --------->ARR14(2)
                                              --------->RVE1(2)               <---------GLK1(2)
                                        <----------DOF2                 <---------WOX13(2)
                                    ---------->ID1                      --------->WOX13(2)         -
   <-------MYC3            ------>ZmHOX2a(1)  --------->GATA12 --------->AHL20(2)     --------->GATA12
   ------->MYC3  ------->TEIL      <-----------GT1  ------------>CBF--------->YAB1    --------->RVE1(2)
 
ataacatgtgtttacccatgaatttgaatccttctatttttctctttcaaatccattcaatttcatttaaaacataatttggattctcaaatccaaaaac  16793700
                                                                                         ------>NtERF2
                                                                                        >>>>>>>>>AtERF-4
                                                                                        >>>>>>>>>AtERF-3
                                                                                      <---------At4g35610
                                                                                      --------->At4g35610
                                                                                      --------->ZAT2
                                                                                      <---------ZAT2
                                                                                      <---------ATERF1(1)
                                                                                      xxxxxxxxxxxxxx
                                                                               <----------DOF2
                                                                              xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                                           xxxxxxxxxxxxxxxx>smallRNA(i)
                                                                     <xxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                           xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2) <xxx
                                                         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3) xxxxx
                                                         <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)   xxxxx
                                                         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)-------
                                                      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)  --------
                                                     <-------TEIL    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                     ------->TEIL    xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                 --------------->AtSPL3    xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                 --------------->AtSPL8  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
                                                 <---------------AtSPL8xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                             <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)     xxxxxxxxxxxxxx
                                             ----------->GT1  --------->At4g35610xxxxxxxxxxxxxxxxxxx
                                             <------MYB83<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<------
                                             <------MYB46(1)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)  -
           <---------KAN1                 <------ZmHOX2a(1)xxxxxxxxxxxxxxxx>smallRNA(i)--------->ATERF1(1)
        --------->YAB5                  <---------TOE2(3)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)<xxxxx
     --------->MYB52(1)       xxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
--------->YAB5               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)   <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
<-----------GT1        *TSS  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
-------->AHL20(2)  <xxxxxxxxxxxxxxxxsmallRNA(i)  <---------------AtSPL3xxxxxxxxxxxxxxxxxxxx>smallRNA(l2)
 
aaataactaaacgaataacaaagtttggacaagttttcaggcttaggatggtaatgtacatcatcaactggagagacatcaactttgggagctgccaatc  16793800
                                                                              <xxxxxxxxxxxxxxxxsmallRNA(i)
                                                                           --------->MYB46(3)
                                                                          --------->ANAC58
                                                                          <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                         <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                        <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                        --------->MYB46(3)
                                                                       xxxxxxxxxxxxxxxx>smallRNA(i)
                                                                       xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                      ------>NtERF2
                                                                      <---------RAP2.6(3)
                                                                     <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                     --------->DEAR3(1)
                                                                     --------->RAP2.3(3)
                                                                    xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                    --------->ATERF1(1)
                                                                    <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                    --------->RAP2.3(1)
                                                                    <------NtERF2
                                                                    --------->DEAR3(2)
                                                                   ------>NtERF2
                                                                <------MYB46(1)
                                                                <------MYB83 <xxxxxxxxxxxxxxxxsmallRNA(i)
                                                                <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                xxxxxxxxxxxxxxxx>smallRNA(s)
                                                                xxxxxxxxxxxxxxxx>smallRNA(i)
                                                               <---------MYB46(3)
                                                               xxxxxxxxxxxxxxxx>smallRNA(i)
                                                              xxxxxxxxxxxxxxxx>smallRNA(i)
                                                              <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                              xxxxxxxxxxxxxxxx>smallRNA(s)
                                                              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                            <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                            --------->YAB5--------->ANAC58
                                                            xxxxxxxxxxxxxxxx>smallRNA(s)
                                                           <---------YAB1<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                           xxxxxxxxxxxxxxxx>smallRNA(s)
                                                           <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                           xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                          <xxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                          xxxxxxxxxxxxxxxx>smallRNA(s)
                                                          <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                         xxxxxxxxxxxxxxxx>smallRNA(i)
                                                        xxxxxxxxxxxxxxxx>smallRNA(i)
                                                       <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                                                      xxxxxxxxxxxxxxxx>smallRNA(i)
                                                      xxxxxxxxxxxxxxxx>smallRNA(s)
                                                      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                    xxxxxxxxxxxxxxxx>smallRNA(s)
                                                    xxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
                                                    xxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                  xxxxxxxxxxxxxxxx>smallRNA(s)<xxxxxxxxxxxxxxxxsmallRNA(s)
                                                 xxxxxxxxxxxxxxxx>smallRNA(s)<xxxxxxxxxxxxxxxxsmallRNA(s)
                                                 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                 <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                xxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                xxxxxxxxxxxxxxxx>smallRNA(i)<xxxxxxxxxxxxxxxxsmallRNA(s)
                                                xxxxxxxxxxxxxxxx>smallRNA(s)------->GAMYB
                                                xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                               xxxxxxxxxxxxxxxx>smallRNA(i)<xxxxxxxxxxxxxxxxsmallRNA(i)
                                               <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                                       xxxxxxxxxxxxxxxx>smallRNA(s)xxxxxxxxxxxxxxxx>smallRNA(s)
                                       <xxxxxxxxxxxxxxxxsmallRNA(s)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                      <xxxxxxxxxxxxxxxxsmallRNA(s)xxxxxxxxxxxxxxxx>smallRNA(s)
                                     xxxxxxxxxxxxxxxx>smallRNA(s)xxxxxxxxxxxxxxxx>smallRNA(s)
                                   --------->ARR11(3)<---------ANAC46--------->ATERF1(2)
                                   <---------ARR11(3)<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                  --------->At4g35610<xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                             --------->ALFIN1xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<---------REM1(1)
                xxxxxxxxxxxxxxxx>smallRNA(se3) <---------DEAR3(1)xxxxxxxxxxxxxxxx>smallRNA(i)
     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<---------ARR11(3)
xxxx>smallRNA(si3)         <---------ZAT2------>ZmHOX2a(1)xxxxxxxxxxxxxxxx>smallRNA(i)
xxxxxxxxxxxxxsmallRNA(i)   --------->ZAT2----------->RAV1(2)--------->ATHB12<xxxxxxxxxxxxxxxxsmallRNA(i)
xxxxxxxxxxxxxxxxxx>smallRNA(i2)   <---------At4g35610xxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)          xx
xxxxxxxxxxxxxxxxx>smallRNA(si3)  <xxxxxxxxxxxxxxxxsmallRNA(s) <---------WOX13(1)--------->ARR11(3)xx
-->RVE1(2)     <----------DOF2 xxxxxxxxxxxxxxxx>smallRNA(i)xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)   xx
->WOX13(1)    <---------DOF5.7(1)xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)<---------ETT(1)             xx
xxxxxxxx>smallRNA(se3)   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)<xxxxxxxxxxxxxxxxsmallRNA(i)        xx
xxx>smallRNA(fl3)        ------>NtERF2xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
---GATA12   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)            xxxx
-------->At4g35610xxxxxxxxxxxxxxxx>smallRNA(i)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)        <xxxxxxxx
xxxxxxxxxxxsmallRNA(i)   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
 
tcagaagaagtctatctcctttacatgccgaggtggaagctctcctctgggcgatgaagtgtatgattggtgccgacaaccaagatgtagtttttcttac  16793900
                                            ------>NtERF2
                        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                   <---------AtMYB61       --------->RAP2.6(2)
                   <xxxxxxxxxxxxxxxxsmallRNA(i)
                  <xxxxxxxxxxxxxxxxsmallRNA(s)
                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                 xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                <---------RVE1(2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                xxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
              xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
              xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
              xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
             <---------ANAC46   xxxxxxxxxxxxxxxx>smallRNA(s)
             xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
             xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
           xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)
          <-----------RAV1(1)   <xxxxxxxxxxxxxxxxsmallRNA(s)
         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3) <----------DOF2
         ------>ZmHOX2a(2)      --------->MYB52(1)
        <------ZmHOX2a(2)      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3) <---------DOF5.7(1)
        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)<---------RAP2.6(3)
        --------->CCA1(2)      <---------ALFIN1xxxxxxxxxxxxxxxx>smallRNA(s)
        xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
        xxxxxxxxxxxxxxxx>smallRNA(s)       <---------ATERF1(2)
       --------->ARR11(2)    <xxxxxxxxxxxxxxxxsmallRNA(s)
       <---------ARR14(2)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
       <---------ARR11(2)<---------ANAC58  <xxxxxxxxxxxxxxxxsmallRNA(s)
       --------->ARR11(3)<---------ANAC58  <---------RAP2.6(2)
       --------->GATA12xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
       <---------GATA12<xxxxxxxxxxxxxxxxsmallRNA(i)
       --------->AGP1  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
       <---------AGP1  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
       --------->ARR14(2)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
       <---------RVE1(2)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
       <---------ARR11(3)<xxxxxxxxxxxxxxxxsmallRNA(s)
      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)<xxxxxxxxxxxxxxxxsmallRNA(i)
      <---------CCA1(2)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
     xxxxxxxxxxxxxxxx>smallRNA(s)------>MYB46(1)
     xxxxxxxxxxxxxxxx>smallRNA(i)xxxxxxxxxxxxxxxx>smallRNA(i)
     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) --------->ATERF1(2)
     ----------->ARR10xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
    xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)  <---------LBD16
   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2) xxxxxxxxxxxxxxxx>smallRNA(s)
  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)               <--------
  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)<---------KAN1                                   <xxxxxxxxxxx
 <---------ZAT14xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)                                    <xxxxxxxxxxxx
xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)------->GAMYB          --------->ARR14(2)      --------->ANAC58
xxxxxxxxxxxxxxxxxxx>smallRNA(se3)-------->P<---------DEAR3(1)                 --------->CCA1(2)
xxxxxxxxxxxxxx>smallRNA(s) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)     xxxxxxxxxxxxxxxx>smallRNA(i)
xxxxxxxxxxxxxxxxxxx>smallRNA(fl3)------>MYB83<------NtERF2<---------ARR14(2) <----------ID1---------
xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)xxxxxxxxxxxxxxxx>smallRNA(i)   <------ZmHOX2a(1) --------->YAB1 <
xxxxxxxxxxxxxxxxxx>smallRNA(i2)--------->MYB46(3)      xxxxxxxxxxxxxxxxxxxxx>smallRNA(se3) <--------
xxxxxxxxxxxxxxxsmallRNA(si3) --------->HSFB2a(2)     xxxxxxxxxxxxxxxx>smallRNA(i) --------->ANAC58 <
 
agactgttcagatctggtggagatggtgtcttccccaaccgaatggccggctttctcatcgtatttggaggagttacagagagacaaggatgagttcaca  16794000
                                                                       xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                                       --------->MYB46(3)
                                                                      -------->P
                                                                      ------>MYB83
                                                                      ------>MYB46(1)
                                                                     --------->MYB52(1)
                                                                   <---------MYB59
                                                                   <xxxxxxxxxxxxxxxxsmallRNA(s)
                                                                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                                                                   --------->MYB46(3)
                                                                  --------->ANAC58
                                                                  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                                  --------->ANAC58
                                                                  --------->ANAC46                 x
                                                                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                          <---------RVE1(2)      --------->SPL7(1)                xx
                                    --------->DAG2             <---------SPL7(1)                  xx
                                   ---------->DOF2            xxxxxxxxxxxxxxxx>smallRNA(s)       ---
                  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)        <---------ANAC58                   <xx
            <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)                <---------ANAC58                  xxxx
          <----------DOF2       --------->TOE2(3)            --------------->AtSPL8           <xxxxx
          <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)              <-------TEIL <xxxxxxxxxxxxxxxxsmallRNA(i)
          --------->TOE2(3)    <---------ZAT6                --------------->AtSPL3           <xxxxx
         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)xxxxx
         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)xxxxx
   <-----------GT1<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)    --------->KAN1------->GAMYB        xxxxxxx
-ZAT18   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)       --------->ANAC58------>MYB46(1)         xxxxxxx
xxxxxsmallRNA(i)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)   --------->DAG2<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
xxxxsmallRNA(i)   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) ---------->DOF2<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
>ZAT18 <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)<-----------GT1xxx
---------DAG2     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)xxxxxxx
-ZAT14<---------CCA1(2)       <---------TOE2(3)      --------->ANAC58------>MYB83 <xxxxxxxxxxxxxxxxx
----------DOF2   xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3) <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)  <xxxxxxx
 
aacttttttctatctttaatctctcgtagtactaatgttaaagtggattttttggcacgaaaagttcgtacccaaccgcttcatattacatttgtaaaca  16794100
                               <---------AHL12(3)
                  <xxxxxxxxxxxxxxxxsmallRNA(i)
              <xxxxxxxxxxxxxxxxsmallRNA(s)
              <xxxxxxxxxxxxxxxxsmallRNA(i)
         xxxxxxxxxxxxxxxx>smallRNA(i)
        --------->ARR14(2)     <---------AHL20(2)
        <---------ARR14(2)     --------->AHL12(3)
        --------->ARR11(2)     --------->AHL25(1)
       <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
       <xxxxxxxxxxxxxxxxsmallRNA(s)
       --------->ATHB12        <---------AHL25(1)
       <------ZmHOX2a(1)       <---------AHL25(2)
      xxxxxxxxxxxxxxxx>smallRNA(s)
      xxxxxxxxxxxxxxxx>smallRNA(i)
     xxxxxxxxxxxxxxxx>smallRNA(i)
     xxxxxxxxxxxxxxxx>smallRNA(s)
    xxxxxxxxxxxxxxxx>smallRNA(i)<---------AHL12(2)
    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
    <-----------RAV1(2)        <---------AHL25(3)
    xxxxxxxxxxxxxxxx>smallRNA(s)--------->AHL12(2)
   xxxxxxxxxxxxxxxx>smallRNA(s)--------->AHL25(2)
   ------>ZmHOX2a(1)          <---------AHL25(3)
  xxxxxxxxxxxxxxxx>smallRNA(s)<---------AHL25(2)
  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
  xxxxxxxxxxxxxxxx>smallRNA(i)--------->AHL25(3)
 xxxxxxxxxxxxxxxx>smallRNA(s) --------->AHL20(2)
 xxxxxxxxxxxxxxxx>smallRNA(i) <---------AHL20(1)
xxxxxxxxxxxxxxxx>smallRNA(s)  --------->AHL12(1)
xxxxxxxxxxxxxxx>smallRNA(s)   <---------AHL20(2)
xxxxxxxxxxxxxx>smallRNA(s)    --------->AHL12(3)
xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
------>KAN1 <xxxxxxxxxxxxxxxxsmallRNA(s)
xxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)     <---------AtLEC2
xxxxxxxxxxxx>smallRNA(s)     --------->AHL25(3)
xxxxxxxxxxxxxxxxxsmallRNA(fl3)<---------AHL12(1)
xxxxxxxxxxxxxxxxxsmallRNA(le3)--------->AHL25(2)
xxxxxxxxxxx>smallRNA(i)     --------->WOX13(2)                          <------ZmHOX2a(1)
xxxxxxxxxxx>smallRNA(s)     <---------WOX13(2)                        <---------TOE2(3)
xxxxxxxxxxxxxxxx>smallRNA(fl3)<---------AHL25(1)                    ---------->DOF2
xxxxxxxxxxxxxxxx>smallRNA(si3)--------->AHL25(1)                <---------KAN1
xxxxxxxxxxxxx>smallRNA(i) --------->ICU4                     --------->YAB5
xxxxxxxxxxxxxxxx>smallRNA(le3)<---------AHL12(3)          --------->MYB52(1)                  <-----
xxxxxxsmallRNA(si3)       ------>ZmHOX2a(1)            <---------AHL12(2)               --------->YAB1
xxxxxxxxxxxxsmallRNA(i2) <---------MYB59  --------->YAB5 --------->DOF5.7(1)   --------->WOX13(2)
 
acattcctcaggattggctcgtttgagtcctaattaatttttggatgacaaaaaaaaaaaaaaacgaataacaaaggattttagttagtatttataaatc  16794200
<- Previous    Next ->

AGI:  At1g44140.1   
Description:  transposable element gene. pseudogene, hypothetical protein
Range:  from: 16793724    to: 16794143    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version