AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                        <---------AHL12(3)
                        --------->AHL12(3)
                        --------->AHL25(1)
                        --------->AHL12(2)
                        <---------AHL25(1)
                        <---------AHL12(2)
                       --------->AHL25(3)
                       --------->AHL20(1)
                       <---------AHL25(2)
                       --------->ARR11(3)
                       <---------AHL12(1)
                       --------->AHL12(1)
                       <---------AHL20(1)
              <---------AHL12(2)
              --------->AHL12(2)
             <---------AHL20(2)
             <---------AHL25(3)
            --------->AHL25(3)
        --------->AHL12(1)
        <---------AHL12(1)
        <---------AHL20(1)
        <---------AHL20(3)
        --------->AHL20(3)                                           <---------AHL12(1)
        --------->AHL20(2)                                           <---------AHL12(2)
        --------->AHL20(1)                                           --------->AHL12(2)
        <---------ARR11(3)                                           --------->AHL12(1)
        --------->ARR11(3)                                          <---------AHL12(1)
        <---------AHL20(2)                                          --------->AHL12(1)
        --------->AHL25(1)                                          --------->AHL25(3)
        <---------AHL25(2)                                      ----------->GT1
        --------->AHL25(3)                                    ---------->DOF2
        --------->AHL25(2)                                --------->DOF5.7(1)
        <---------AHL25(1)                           --------------->AGL15
        <---------AHL25(3)                           <---------------AGL15
       --------->AHL12(2)  <-----------GT1          ----------------->AGL2
  ----------->GT1      <---------ARR11(3)           ----------------->AGL3
--------TOE2(3)      <---------RVE1(2)  --------->AHL20(2)---------->DOF2     --------->RVE1(2)
-----YAB1   --------->AHL20(2)   --------->RVE1(2) ------------------------>ANAC81 --------->WOX13(2)
 
taatgtagtaatatattaaatattgatatatttctatatcaaatttaaaactaaaaccaaaaaaagaaagaaaaatttctatatcaaatttagaactaaa  16619200
            <-----------HVH21
           <---------ZAT6
    --------->AHL20(3)
    --------->AHL20(2)
    <---------AHL20(3)                         --------->KAN1
    --------->AHL25(2)                     <----------DOF2                                  <-------
    <---------AHL12(3)                  ------>MYB46(1)                                     --------
    --------->AHL12(3)                <---------MYB59                                      <--------
   <---------AHL25(3)              <-----------GT1                       <---------ANAC46  <--------
   --------->YAB1             <----------DOF2<-----------GT1           <---------ANAC46   <---------RVE1(2)
  --------->AHL20(2)  <---------MYB52(1)------>MYB83          --------->ZAT6  <---------WOX13(2)
 
aacaaataaaaatagtgtcatttccattatgttcttttaaaccaaactttacattctaagaaaaaacactattgatgtgtatattaaacttttgatatct  16619300
                                                                                      ----------->GT1
                                                                                      <----------ID1
                                                                             <---------AHL20(3)
                                                                             --------->AHL25(3)
                                                                             --------->AHL20(2)
                                                                             <---------AHL20(1)
                                                                             --------->AHL20(1)
                                                      --------->YAB1         <---------AHL20(2)
                                                      <-----------GT1        --------->AHL20(3)
                                                   <---------AHL12(2)        --------->AHL25(2)
  --------->RVE1(2)       ---------->DOF2          --------->AHL12(2)        <---------AHL25(1)
--ARR11(3)            <---------WOX13(2)           --------->YAB1           <---------ATHB12
->ARR11(3)       <---------TOE2(3)            ----------->GT1   --------->ZAT6      --------->DOF5.7(1)
-GLK1(1)         <---------TOE1(3)       <---------YAB1       <-----------GT1--------->AHL25(1)  ---
-CCA1(2) <----------DOF2<---------AHL20(2) <---------AtLEC2 --------->AHL20(2)    ---------->DOF2<--
 
ttctaaatcaaacttttcttaaggtatttaaaagtgatagtattctgaatggaaaaataacaatttaacactaaaaccaataaaataaagagaaaaatgt  16619400
                             --------->YAB5
                            <---------YAB1
                          ----------->GT1
                        <---------GLK1(2)
                  --------->RVE1(2)
               --------->AHL20(2)                          <-----------HVH21
               --------->AHL25(2)                         --------->bZIP60(2)
               --------->AHL12(3)                       <---------ANAC58             >>>>>>>>>TBF1
               <---------AHL25(1)                       <---------ANAC58          >>>>>>>>>TBF1
------>MYB52(2)<---------AHL12(2)                  --------->HSFB2a(2)         >>>>>>>>>TBF1
---------RAV1(1)<---------AHL12(1)      <---------AHL12(2)<---------KAN1<----------DOF2
 
ttgtggctaacaaaaaaaaaaaatccagattgtgattacaaaaaaaaaacatttctagggcatgtcattgacttcctttgaagaagaagaagaagagaga  16619500
                                                                      --------->ZAT18
                                           =================================HOX2a_HOX2a
                                           <------ZmHOX2a(2)       --------->ANAC58
                                     <---------GATA12           <------NtERF2
                                   <---------AHL25(3)           --------->LBD16
                                   <---------AHL25(1)          --------->ANAC58
                                   <---------AHL12(1)          --------->ANAC46
                                  <---------AHL25(1)           --------->ANAC58
                                  <---------AHL12(3)          <---------LBD16
                                  --------->AHL25(3)        <---------SPL7(1)
                                  --------->AHL20(2)       <---------TGA1a
                     ---------->DOF2--------->KAN1         --------->TGA1a
                     ================================================bZIP_DOF
               ----------->GT1    --------->AHL12(3)       =========================================
              --------->DAG2  --------->AHL20(2)           <---------ANAC58
             --------->DOF5.7(1)  --------->AHL25(1)  <---------ICU4 <------ZmHOX2a(1)             <
             ---------->DOF2 ----------->GT1     ------------>CBF  --------->ANAC58 <---------------
         <----------ID1--------->DOF5.7(1)--------->GATA12 <---------ANAC58--------->ZAT14 *TSS   <-
       ---------->DOF2--------->DOF5.7(1) <---------GATA12 --------->bZIP60(1)      <---------DOF5.7(1)
 
gagagactgaaaaagaaaaagtaagaaagggaatgaaataaatccgatcgaatacaattttgacgtccgcaaggacactattctctctcttctcatcttc  16619600
                                                                               --------->WOX13(2)
                                                                             <---------AHL20(2)
                                                                            --------->AHL20(2)
                                                                           --------->AHL12(2)
                                                                         --------->ICU4
                                                                        --------->AHL12(2)
                                                                        --------->AHL25(2)
                                                                        <---------AHL20(3)
                                                                        <---------AHL25(2)
                                                                        --------->AHL12(3)
                                                                        --------->AHL20(3)
      <---------DOF5.7(1)                                         ----------->GT1
==========bZIP_DOF                   <------ZmHOX2a(1)           --------->DAG2<---------WOX13(2)
----------DOF2                      --------->ANAC46       <---------------AGL15        --------->LBD16
---------ANAC81        <---------ZAT14                    --------->TOE1(3)<---------AHL12(2)
--------DOF5.7(1)      --------->ZAT14        <-----------GT1  ---------->DOF2--------->YAB1
 
ttctttctctcttctctctctctctctacagcgaagaacaggacacaaattactctgtgaagcttaaaaaggtataatttttaataaaacccagaaacta  16619700
                  --------->AHL12(2)
                 --------->AHL12(1)
             ----------->GT1
            <------NtERF2
         <------NtERF2
         <---------At4g35610
         --------->At4g35610
         --------->ATERF1(1)
        ----------->RAV1(1)
        <---------RAP2.3(1)
        ------>NtERF2
       <---------DEAR3(1)
       <---------RAP2.3(2)                                   <----------DOF2
       <---------RAP2.6(2)                               ---------->ID1                  --------->TOE2(3)
       --------->ATERF1(2)                               <---------CCA1(2)               --------->TOE1(3)
       <---------ATERF1(2)                   <----------DOF2<---------DOF5.7(1)   --------->AHL20(2)
      --------->RAP2.6(3)                   <---------DOF5.7(1)                   --------->YAB1
   --------->HSFB2a(2)                <------------------------ANAC81        <---------ATHB12-------
   <---------HSFB2a(2)           <----------DOF2 ---------->ID1     --------->LBD16<---------AHL12(2)
 
caatttctaggcggcagagaaaatttgtttctacttctttttgtttctctttgtcttctcgtctctttatccccaaacccatcaataaaaaaccctaaaa  16619800
                         --------->At4g35610         ---------->DOF2       <---------GLK1(2)
                         <---------At4g35610      <---------ANAC46         <---------RVE1(2)
               <---------ARR14(3)       <---------RVE1(1)         <---------DOF5.7(1)
               <---------GLK1(2)       <---------RVE1(2)         <---------DOF5.7(1)
               --------->ARR11(3)      <---------GLK1(2)         <----------DOF2 <----------DOF2
               <---------ARR11(3)      --------->ARR11(3)        <---------DAG2 <---------DOF5.7(1)
--->DOF2       --------->ARR14(3)      --------->GATA12         <---------DOF5.7(1)              <--
 
gacttcaaatttcttcaagattttgttcatcggaagttttcagatttttagttgtgtaaagtctcttcctttttgttcgattctctttgttttgagtctt  16619900
                                                                              <---------TOE2(3)
                                                                              <---------TOE1(3)
                                                   --------->YAB1         <---------WOX13(2)      <-
                                               --------->ZAT6             --------->WOX13(2)     <--
        <---------YAB1       <--------P   <---------RVE1(2)            --------------->AGL15   <----
      --------->KAN1  --------->AtMYB61   <---------GLK1(2)         <-----------GT1            <----
-------YAB1        <---------ALFIN1      --------->KAN1       <---------MYB52(1)               <----
 
atcagagacttattcttcaattccacctctgggtaagtttctatagattctcactagtaatctctgttttttttctcaattagggtttgatcaaagtttc  16620000
                                                                                       --------->ARR14(2)
                                                                                       <---------ARR11(3)
                                                                                       --------->ARR11(2)
                                                                                       --------->ARR11(3)
                                                                                       <---------AGP1
                                                                                       --------->AGP1
                                                                                       <---------RVE1(2)
                                                                                       <---------ARR11(2)
                                                                                       <---------ARR14(2)
                                                                                 --------->WOX13(2)
                                                                                 <---------WOX13(2)
                                                                              --------------->AGL15
                                                                              <---------------AGL15
                                                                             <---------ANAC58
                                                                             <-----------------AGL3
                                                                             <---------ANAC58
     <----------DOF2                             <---------MYB46(3)     <---------GATA12
  <-----------GT1                            --------->DOF5.7(1)        --------->ARR14(2)
--------DOF5.7(1)                            <---------TOE2(3)          <---------ARR14(2)         <
-------MYB52(1)                              <---------AtMYB61          <---------RVE1(2)------>ZmHOX2a(2)
-----ANAC46                     <----------DOF2 --------->ALFIN1        --------->GATA12<------ZmHOX2a(2)
-----ANAC58    <---------MYB46(3)            <---------TOE1(3)        ----------->ARR10--------->GATA12
-----ANAC58    --------->KAN1<---------YAB1  --------->DAG2        <---------ANAC46    <---------GATA12
 
gtttttttctttctgggtttgttcttaacattatgcttttgttttgttaaggtggtgagagttggaaatggagtagatttgcttaatttagatctgtaag  16620100
<- Previous    Next ->

AGI:  At1g43850.1   
Description:  SEU (SEUSS); transcription cofactor. Identical to Transcriptional corepressor SEUSS (SEU) [Arabidopsis Thaliana] (GB:Q8W234;GB:Q8GXE8;GB:Q9MAR3); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G62090.1); similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G62090.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO60899.1)
Range:  from: 16619592    to: 16624489    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version